Спираль ДНК. Лестница, ведущая в небо. Лестница днк


Спираль ДНК. Лестница, ведущая в небо. Чего не знает современная наука

Спираль ДНК. Лестница, ведущая в небо

Что такое жизнь? Этот вопрос стал движущей силой развития генетики (от греческого genetikos – «относящийся к рождению, происхождению») – науки о происхождении жизни, в центре внимания которой вот уже более 50 лет находится молекула ДНК.

Открытие, которое перевернуло мир

«Мы только что открыли секрет жизни!» – так 28 февраля 1953 года Френсис Крик и Джеймс Уотсон сообщили о своем открытии структуры ДНК.

Что нового привнесло оно в науки о жизни? До этого было известно, что ДНК – большая молекула, в которой с помощью «четырехбуквенного алфавита» записана информация о строении и свойствах живых существ. Но оставалось непонятным, как эта информация передается из поколения в поколение и материализуется в эти самые структуры и свойства, а также какова пространственная структура ДНК.

Разгадка структуры ДНК помогла ученым понять механизмы ее копирования и материализации. ДНК состоит из двух цепей, которые комплементарны (дополнительны) друг другу. Копирование ДНК происходит за счет достраивания на каждой исходной цепи ДНК, как на матрице, дополнительной к ней копии. Так из одной двойной спирали ДНК получаются две абсолютно идентичные ей двойные спирали, что и необходимо для сохранения генетической информации при делении материнской клетки на две дочерние. Матричный принцип лежит также в основе поэтапной материализации генетической информации: на одной из цепей ДНК образуется комплементарная ей цепь другой информационной молекулы – РНК, которая, в свою очередь, служит матрицей для синтеза белков, от количества и качества которых зависят структуры и свойства конкретного организма.

Насколько это открытие значимо для постижения тайны жизни? С одной стороны, знания структуры ДНК явно недостаточно для того, чтобы ответить на вопрос «что такое жизнь?». Но с другой – именно это открытие сделало «научным» очень древний и очень важный вопрос о взаимосвязи потенциального и проявленного – на примере связи информации о структурах и свойствах организма с самими структурами и свойствами. И не только поставило этот вопрос, но и дало ключ к ответу на него. Этот ключ – матричный принцип, принцип комплементарности.

Путь от гена до признака

Что означает классическая фраза из учебника: «ДНК – носитель генетической информации»? Как генетическая информация связана со структурой ДНК? Каким образом информация воплощается в конкретных свойствах организма? Если за точку отсчета генетической информации принять структуру ДНК и далее следовать структурной модели, то путь от гена до признака будет выглядеть так: в последовательности ДНК зашифрованы все свойства организма; линейная структура конкретного гена однозначно определяет линейную структуру соответствующего ему белка, которая, в свою очередь, однозначно определяет роль этого белка в формировании того или иного признака. Другими словами, «ДНК рождает РНК; РНК рождает белок, а белок рождает нас с вами» (Ф. Крик). Если это верно, то для того, чтобы изменить тот или иной признак (например, вылечить болезнь, имеющую генетические корни), достаточно установить соответствующую ему последовательность участка ДНК и исправить ее. Но так ли все просто? Достаточно ли знаний (хотя они бесспорно верны и необходимы!) о структурных соответствиях на пути от гена к признаку, для того чтобы понять и воспроизвести этот путь?

Последние достижения генетики показали, что недостаточны. В 2003 году в рамках проекта «Геном человека» была полностью определена линейная структура ДНК человека (и многих других простых и сложных организмов). Как сказал один из ученых, «прочитаны все буквы, которыми написана толстая книга, теперь еще понять бы слова и их смысл». Выяснилось, что собственно генов (участков ДНК, кодирующих белки) у человека около 30 000, и это лишь 1–3 % всей ДНК! Столько же генов у растения Arabidopsis taliana и рыбы фугу. Более того, 99 % генов человека совпадают с генами мыши, то есть человек имеет всего 300 генов, которых нет у мыши. (Трудно представить, что у нас и мышей одинаковы еще и 99 % признаков!)

Дальше – больше. Оказалось, что однозначная взаимосвязь между геном и белком существует только у бактерий. А у человека возможно образование многих белков на основании одного гена (максимально известное сегодня число разных белков, кодируемых одним геном, – 40 000!) и возникновение многих функций у одного белка. Получается, что путь от потенциального к проявленному, от генетической информации к признаку отнюдь не линейный; что каждый признак является результатом сложных взаимодействий многих генов и их продуктов-белков; что само понятие «ген» из-за своей неоднозначности вряд ли может служить «отправным пунктом» этого пути.

Взаимодействие структур

Тело человека состоит из 1014 клеток. Все они имеют абсолютно одинаковую ДНК, но существенно различаются по форме, размерам и своим задачам. Разрешение этого парадокса – в избирательном считывании генетической информации. В каждой клетке активными являются только те гены, которые ей в данный момент необходимы. Избирательность обеспечивают специальные гены-регуляторы, которые разрешают или запрещают считывание информации с того или иного участка ДНК. Активность гена зависит и от его окружения в пространстве клеточного ядра. Смена окружения, вызванная перемещением самого гена или кого-то из его соседей, способна изменить его активность («выключить» или «включить» ген). Например, в геноме человека есть масса потенциально опасных вирусных генов и протоонкогенов (способных вызвать раковое перерождение клетки). Они могут долгое время (и всю жизнь) вести себя вполне мирно и даже работать на благо клетки, до тех пор пока перемещение их самих или кого-то из окружения не выявит в этих генах агрессивные потенциалы. К счастью, могут произойти другие перемещения, которые утихомирят «бунтовщика» или включат защитные механизмы.

Итак, носитель генетической информации переместился с уровня гена (конкретного участка ДНК) на эпигенетический (от латинского «над», «сверх») уровень взаимодействия генов между собой и с другими структурами ядра клетки (99 % негенной ДНК и белками). Предположим, наука расшифрует механизм этого взаимодействия. Приведет ли это к раскрытию тайны жизни? Жизнь – это только лишь структура? А если нет, стоит ли в поисках разгадки тайны жизни ограничиваться взаимодействием структур?

Кто сторожит сторожа?

Как из единственной клетки в результате 46 делений получается не бесформенная масса из 1014 клеток, а весьма характерное тело каждого из нас? Последовательно удваиваясь, клетки не только сами становятся разными, но еще и формируют разные части тела в нужное время и в нужном месте. Что управляет организацией клеток во времени и пространстве? Целое, которое качественно больше простой суммы составляющих его частей-клеток. И это не противоречит тому, что организм образуется из одной клетки, – вопрос в том, что для этой клетки воплощает «волю целого». Поиски подобного упорядочивающего фактора вылились в начале XX века в концепцию морфогенетического поля. Ее основоположником стал русский ученый А. Г. Гурвич.

Когда Гурвич работал над теорией поля, молекула ДНК считалась составной частью хромосом, и ей не придавали особого значения. В 1944 году ученый опубликовал свой труд «Теория биологического поля». Этот год стал судьбоносным для всей генетики, определив путь ее развития на несколько десятилетий вперед. В центре внимания ученых оказалась молекула ДНК, поскольку было доказано, что именно ей принадлежит ведущая роль в передаче наследственной информации. Не за горами был и 1953-й… В результате все свое внимание наука сосредоточила на структуре ДНК, которую фактически стала отождествлять с переносимой ею информацией, а теория биологического поля оказалась не в почете. Но исследования в этой области продолжались, и все эти годы два пути познания тайны жизни шли параллельно…

Переход в новое тысячелетие изменил соотношение сил в науках о жизни. Все больше ученых приходят к тому, что структурный ключ в познании живого необходим, но недостаточен; что разные подходы не исключают друг друга, а образуют объединенный путь научного поиска; что по сути своей структурный подход и теория поля комплементарны. Вспомним: именно предположение о комплементарности цепей ДНК стало ключом к расшифровке ее структуры, а само открытие 1953 года оказалось возможным благодаря комплементарности усилий представителей разных областей науки – физиков, химиков, биологов. Может быть, объединенная наука нового тысячелетия не только окончательно примирит разные научные подходы (например, структурный и полевой), но и обратится к плодам «ненаучного» пути познания тайны жизни – тысячелетней мудрости человечества, – «ненаучного», поскольку этот путь уходит корнями в те времена, когда науки не было и в помине. Обращение к источникам древней мудрости способно дать науке ключи от двери, за которой скрыта тайна. Но чтобы это произошло, столь разные пути познания должны где-то «пересечься». Одним из таких «перекрестков» может стать концепция формообразующего поля (биологического, морфогенетического, информационного), выросшая на почве современной науки и восходящая к явлениям, рассматривавшимся в древних источниках. Последние говорят о том, что человек состоит из нескольких тел, или принципов, которые не являются отдельными, независимыми частями, а взаимопроникают и взаимоформируют друг друга; что видимое, плотное, физическое тело является проводником, носителем более тонкоматериальных тел, которые с его помощью проявляются в физическом мире и взаимодействуют с ним; что «сборкой» – формированием физического тела из элементов физической материи – управляет самое «плотное» из этих тел, астральное тело-прообраз (план, матрица).

Современная наука знает, что каждая вновь образовавшаяся клетка участвует в формировании организма согласно индивидуальной «инструкции» (активные, или включенные, гены) и что у родителя и у потомков этой клетки могут быть совсем другие «инструкции». Но что и как согласует переключения индивидуальных «программ» развития миллиардов клеток, пока не ясно. Теория биологического поля предполагает, что согласование есть функция целого, которое и является тем самым полем, матрицей или моделью; что каждая вновь образовавшаяся клетка с помощью собственного генетического аппарата подключается к единому «плану» развития организма, получает оттуда индивидуальные «инструкции» и реализует их в рамках собственной программы поведения. Получается, что генетический аппарат клетки состоит, как минимум, из трех функциональных блоков: воспринимающей «антенны», «пульта управления» активностью генов и «исполнительной» части – генов, ответственных за образование конкретных белков. Вспомним, что на долю генов приходится всего 1–2 % от всей клеточной ДНК. В оставшихся 98–99 % ДНК уже обнаружены структуры, относящиеся ко второму «управляющему блоку». А что играет роль «антенны»? Где происходит «встреча двух миров» – информационного поля и генетических структур, воплощающих эту информацию в конкретное физическое тело?

Мост от потенциального к проявленному

Почему бы не предположить, что роль антенны, способной улавливать, трансформировать и передавать сигналы волновой природы, тоже играет ДНК? К этому располагает и спиральная структура «молекулы жизни» (многие технические антенны имеют форму спирали), и такие ее свойства, как способность проводить электрический ток, возможность резонансного возбуждения продольных колебаний под действием радиоволн, а также способность к лазерной генерации света после предварительной «накачки».

Если ДНК может работать на прием информации, обеспечивающей жизненную активность клеток, то ей вовсе не обязательно постоянно хранить эту информацию в своей структуре. Как, например, мозгу человека, чтобы успешно управлять системами жизнеобеспечения организма, не обязательно быть «вместилищем» разума, а достаточно играть роль посредника между сознанием и телом: он воспринимает информацию из плана сознания и «переводит» ее на язык управления телом.

И ясно, почему в случае повреждений структуры ДНК (или мозговых структур) страдает физическое тело. Ведь всем известно, что при неисправности в телевизоре хотя бы одной детали изображение на его экране сильно искажается, а если телевизор лишить антенны или выключить его из сети, на экране вообще ничего не появится.

ДНК – связующее звено между «моделью» физического тела и ее конкретным воплощением. Мозг – посредник между разумом и телом. Разум связывает жизнь и форму ее проявления и позволяет жизни, заключенной в форме, познавать саму себя. С помощью этого замечательного инструмента человек имеет возможность изучать окружающий мир и находить в нем ключи к познанию своего внутреннего мира. Так рождается объединенный путь, ведущий к познанию тайны жизни. Ибо человек есть величайшая из тайн – тайна взаимосвязи земли и неба.

Наталья Аднорал, канд. мед. наук

Поделитесь на страничке

Следующая глава >

public.wikireading.ru

Журнал «Человек без границ» - Спираль ДНК. Лестница, ведущая в небо

Что такое жизнь? Этот вопрос стал движущей силой развития генетики (от греческого genetikos — «относящийся к рождению, происхождению») — науки о происхождении жизни, в центре внимания которой вот уже более 50 лет находится молекула ДНК.

Открытие, которое перевернуло мир«Мы только что открыли секрет жизни!» — так 28 февраля 1953 года Френсис Крик и Джеймс Уотсон сообщили о своем открытии структуры ДНК.Что нового привнесло оно в науки о жизни? До этого было известно, что ДНК — большая молекула, в которой с помощью «четырехбуквенного алфавита» записана информация о строении и свойствах живых существ. Но оставалось непонятным, как эта информация передается из поколения в поколение и материализуется в эти самые структуры и свойства, а также какова пространственная структура ДНК.

Разгадка структуры ДНК помогла ученым понять механизмы ее копирования и материализации. ДНК состоит из двух цепей, которые комплементарны (дополнительны) друг другу. Копирование ДНК происходит за счет достраивания на каждой исходной цепи ДНК, как на матрице, дополнительной к ней копии. Так из одной двойной спирали ДНК получаются две абсолютно идентичные ей двойные спирали, что и необходимо для сохранения генетической информации при делении материнской клетки на две дочерние. Матричный принцип лежит также в основе поэтапной материализации генетической информации: на одной из цепей ДНК образуется комплементарная ей цепь другой информационной молекулы — РНК, которая, в свою очередь, служит матрицей для синтеза белков, от количества и качества которых зависят структуры и свойства конкретного организма.Насколько это открытие значимо для постижения тайны жизни? С одной стороны, знания структуры ДНК явно недостаточно для того, чтобы ответить на вопрос «что такое жизнь?». Но с другой — именно это открытие сделало «научным» очень древний и очень важный вопрос о взаимосвязи потенциального и проявленного — на примере связи информации о структурах и свойствах организма с самими структурами и свойствами. И не только поставило этот вопрос, но и дало ключ к ответу на него. Этот ключ — матричный принцип, принцип комплементарности.

Путь от гена до признакаЧто означает классическая фраза из учебника: «ДНК — носитель генетической информации»? Как генетическая информация связана со структурой ДНК? Каким образом информация воплощается в конкретных свойствах организма? Если за точку отсчета генетической информации принять структуру ДНК и далее следовать структурной модели, то путь от гена до признака будет выглядеть так: в последовательности ДНК зашифрованы все свойства организма; линейная структура конкретного гена однозначно определяет линейную структуру соответствующего ему белка, которая, в свою очередь, однозначно определяет роль этого белка в формировании того или иного признака. Другими словами, «ДНК рождает РНК; РНК рождает белок, а белок рождает нас с вами» (Ф. Крик). Если это верно, то для того, чтобы изменить тот или иной признак (например, вылечить болезнь, имеющую генетические корни), достаточно установить соответствующую ему последовательность участка ДНК и исправить ее. Но так ли все просто? Достаточно ли знаний (хотя они бесспорно верны и необходимы!) о структурных соответствиях на пути от гена к признаку, для того чтобы понять и воспроизвести этот путь?Последние достижения генетики показали, что недостаточны. В 2003 году в рамках проекта «Геном человека» была полностью определена линейная структура ДНК человека (и многих других простых и сложных организмов). Как сказал один из ученых, «прочитаны все буквы, которыми написана толстая книга, теперь еще понять бы слова и их смысл». Выяснилось, что собственно генов (участков ДНК, кодирующих белки) у человека около 30 000, и это лишь 1–3% всей ДНК! Столько же генов у растения Arabidopsis taliana и рыбы фугу. Более того, 99% генов человека совпадают с генами мыши, то есть человек имеет всего 300 генов, которых нет у мыши. (Трудно представить, что у нас и мышей одинаковы еще и 99% признаков!)Дальше — больше. Оказалось, что однозначная взаимосвязь между геном и белком существует только у бактерий. А у человека возможно образование многих белков на основании одного гена (максимально известное сегодня число разных белков, кодируемых одним геном, — 40 000!) и возникновение многих функций у одного белка. Получается, что путь от потенциального к проявленному, от генетической информации к признаку отнюдь не линейный; что каждый признак является результатом сложных взаимодействий многих генов и их продуктов-белков; что само понятие «ген» из-за своей неоднозначности вряд ли может служить «отправным пунктом» этого пути.

Взаимодействие структурТело человека состоит из 1014 клеток. Все они имеют абсолютно одинаковую ДНК, но существенно различаются по форме, размерам и своим задачам. Разрешение этого парадокса — в избирательном считывании генетической информации. В каждой клетке активными являются только те гены, которые ей в данный момент необходимы. Избирательность обеспечивают специальные гены-регуляторы, которые разрешают или запрещают считывание информации с того или иного участка ДНК. Активность гена зависит и от его окружения в пространстве клеточного ядра. Смена окружения, вызванная перемещением самого гена или кого-то из его соседей, способна изменить его активность («выключить» или «включить» ген). Например, в геноме человека есть масса потенциально опасных вирусных генов и протоонкогенов (способных вызвать раковое перерождение клетки). Они могут долгое время (и всю жизнь) вести себя вполне мирно и даже работать на благо клетки, до тех пор пока перемещение их самих или кого-то из окружения не выявит в этих генах агрессивные потенциалы. К счастью, могут произойти другие перемещения, которые утихомирят «бунтовщика» или включат защитные механизмы.Итак, носитель генетической информации переместился с уровня гена (конкретного участка ДНК) на эпигенетический (от латинского «над», «сверх») уровень взаимодействия генов между собой и с другими структурами ядра клетки (99% негенной ДНК и белками). Предположим, наука расшифрует механизм этого взаимодействия. Приведет ли это к раскрытию тайны жизни? Жизнь — это только лишь структура? А если нет, стоит ли в поисках разгадки тайны жизни ограничиваться взаимодействием структур?

Кто сторожит сторожа?Как из единственной клетки в результате 46 делений получается не бесформенная масса из 1014 клеток, а весьма характерное тело каждого из нас? Последовательно удваиваясь, клетки не только сами становятся разными, но еще и формируют разные части тела в нужное время и в нужном месте. Что управляет организацией клеток во времени и пространстве? Целое, которое качественно больше простой суммы составляющих его частей-клеток. И это не противоречит тому, что организм образуется из одной клетки, — вопрос в том, что для этой клетки воплощает «волю целого». Поиски подобного упорядочивающего фактора вылились в начале XX века в концепцию морфогенетического поля. Ее основоположником стал русский ученый А.Г. Гурвич.Когда Гурвич работал над теорией поля, молекула ДНК считалась составной частью хромосом, и ей не придавали особого значения. В 1944 году ученый опубликовал свой труд «Теория биологического поля». Этот год стал судьбоносным для всей генетики, определив путь ее развития на несколько десятилетий вперед. В центре внимания ученых оказалась молекула ДНК, поскольку было доказано, что именно ей принадлежит ведущая роль в передаче наследственной информации. Не за горами был и 1953-й... В результате все свое внимание наука сосредоточила на структуре ДНК, которую фактически стала отождествлять с переносимой ею информацией, а теория биологического поля оказалась не в почете. Но исследования в этой области продолжались, и все эти годы два пути познания тайны жизни шли параллельно...Переход в новое тысячелетие изменил соотношение сил в науках о жизни. Все больше ученых приходят к тому, что структурный ключ в познании живого необходим, но недостаточен; что разные подходы не исключают друг друга, а образуют объединенный путь научного поиска; что по сути своей структурный подход и теория поля комплементарны. Вспомним: именно предположение о комплементарности цепей ДНК стало ключом к расшифровке ее структуры, а само открытие 1953 года оказалось возможным благодаря комплементарности усилий представителей разных областей науки — физиков, химиков, биологов. Может быть, объединенная наука нового тысячелетия не только окончательно примирит разные научные подходы (например, структурный и полевой), но и обратится к плодам «ненаучного» пути познания тайны жизни — тысячелетней мудрости человечества, — «ненаучного», поскольку этот путь уходит корнями в те времена, когда науки не было и в помине. Обращение к источникам древней мудрости способно дать науке ключи от двери, за которой скрыта тайна. Но чтобы это произошло, столь разные пути познания должны где-то «пересечься». Одним из таких «перекрестков» может стать концепция формообразующего поля (биологического, морфогенетического, информационного), выросшая на почве современной науки и восходящая к явлениям, рассматривавшимся в древних источниках. Последние говорят о том, что человек состоит из нескольких тел, или принципов, которые не являются отдельными, независимыми частями, а взаимопроникают и взаимоформируют друг друга; что видимое, плотное, физическое тело является проводником, носителем более тонкоматериальных тел, которые с его помощью проявляются в физическом мире и взаимодействуют с ним; что «сборкой» — формированием физического тела из элементов физической материи — управляет самое «плотное» из этих тел, астральное тело-прообраз (план, матрица).Современная наука знает, что каждая вновь образовавшаяся клетка участвует в формировании организма согласно индивидуальной «инструкции» (активные, или включенные, гены) и что у родителя и у потомков этой клетки могут быть совсем другие «инструкции». Но что и как согласует переключения индивидуальных «программ» развития миллиардов клеток, пока не ясно. Теория биологического поля предполагает, что согласование есть функция целого, которое и является тем самым полем, матрицей или моделью; что каждая вновь образовавшаяся клетка с помощью собственного генетического аппарата подключается к единому «плану» развития организма, получает оттуда индивидуальные «инструкции» и реализует их в рамках собственной программы поведения. Получается, что генетический аппарат клетки состоит, как минимум, из трех функциональных блоков: воспринимающей «антенны», «пульта управления» активностью генов и «исполнительной» части — генов, ответственных за образование конкретных белков. Вспомним, что на долю генов приходится всего 1–2% от всей клеточной ДНК. В оставшихся 98–99% ДНК уже обнаружены структуры, относящиеся ко второму «управляющему блоку». А что играет роль «антенны»? Где происходит «встреча двух миров» — информационного поля и генетических структур, воплощающих эту информацию в конкретное физическое тело?

Мост от потенциального к проявленномуПочему бы не предположить, что роль антенны, способной улавливать, трансформировать и передавать сигналы волновой природы, тоже играет ДНК? К этому располагает и спиральная структура «молекулы жизни» (многие технические антенны имеют форму спирали), и такие ее свойства, как способность проводить электрический ток, возможность резонансного возбуждения продольных колебаний под действием радиоволн, а также способность к лазерной генерации света после предварительной «накачки».Если ДНК может работать на прием информации, обеспечивающей жизненную активность клеток, то ей вовсе не обязательно постоянно хранить эту информацию в своей структуре. Как, например, мозгу человека, чтобы успешно управлять системами жизнеобеспечения организма, не обязательно быть «вместилищем» разума, а достаточно играть роль посредника между сознанием и телом: он воспринимает информацию из плана сознания и «переводит» ее на язык управления телом.И ясно, почему в случае повреждений структуры ДНК (или мозговых структур) страдает физическое тело. Ведь всем известно, что при неисправности в телевизоре хотя бы одной детали изображение на его экране сильно искажается, а если телевизор лишить антенны или выключить его из сети, на экране вообще ничего не появится.ДНК — связующее звено между «моделью» физического тела и ее конкретным воплощением. Мозг — посредник между разумом и телом. Разум связывает жизнь и форму ее проявления и позволяет жизни, заключенной в форме, познавать саму себя. С помощью этого замечательного инструмента человек имеет возможность изучать окружающий мир и находить в нем ключи к познанию своего внутреннего мира. Так рождается объединенный путь, ведущий к познанию тайны жизни. Ибо человек есть величайшая из тайн — тайна взаимосвязи земли и неба.

Дополнительно:

Увлекшись структурой ДНК, молекулярно-биологический мир как-то забыл, что главный вопрос, на который он должен был бы ответить, — это вопрос, задаваемый всеми поколениями мыслителей: «что такое жизнь?». Открытие структуры ДНК было одним из самых крупных шагов в этом поиске. К сожалению... столь необходимый шаг все-таки очень недостаточен для ответа на главный вопрос о феномене жизни. Но благодаря ДНК наука получила такой импульс, что, возможно, сегодня мы можем попытаться ответить на него.Е.Д. Свердлов, академик,директор Института молекулярной генетики

Пространственная модель ДНКДНК состоит из двух цепей, закрученных одна вокруг другой. Каждая цепь построена из четырех «букв», нуклеотидов, — повторяющихся элементов четырех типов. Каждый нуклеотид состоит из фосфатной группы, сахара и одного из четырех азотистых оснований. Получается двойная спираль, по форме напоминающая веревочную лестницу. Роль «веревок» в ней играют сахарофосфатные остовы обоих цепей, а роль «перекладин» — азотистые основания. Каждая «перекладина» состоит из двух оснований, присоединенных к двум противоположным цепям и связанных между собой водородными «мостиками» по принципу ключ-замок.

Ген — это участок ДНК, кодирующий полную аминокислотную последовательность какого-либо белка. Термин (от греческого genos — «происхождение») в 1909 году ввел датский ботаник В.Л. Иогансен, имея в виду «участок хромосомы, контролирующий какую-то характеристику».Геном — это совокупность всей наследственной информации организма. В состав генома человека входит 46 хромосом ядра клетки и митохондриальная ДНК.Проект «Геном человека» (1991–2003) — полная расшифровка последовательности нуклеотидов в ДНК Homo sapiens.

Реальный вызов биологии человека, идущий далее простого выяснения, как гены дирижируют конструкцией и поддержанием нашего тела, ждет нас впереди. Мы должны понять, как наше сознание пришло к такой высокой организации, чтобы начать исследовать наше существование.К. Вентер, руководитель группы ученых,расшифровавших геном человека

Поле — это особая форма материи, связывающая частицы вещества в единые системы и передающая с конечной скоростью действия одних частиц на другие.Морфогенез (от греческого morphe — «форма» и genesis — «происхождение, возникновение») — возникновение новых форм и структур в процессе развития.Некоторые положения теории поля ГурвичаВ основе процесса формирования организма лежит принцип соподчинения элементов единому целому. Целое — единое поле организма, несущее всю необходимую информацию о его строении; «план», определяющий и направляющий пространственное распределение клеток. Единое поле организма есть сумма полей составляющих его клеток. Источник поля каждой клетки находится в хромосомах.

www.bez-granic.ru

Спираль ДНК. Лестница, ведущая в небо | DNA SOLUTIONS

10.01.2011

Что такое жизнь? Этот вопрос стал движущей силой развития генетики (от греческого genetikos — «относящийся к рождению, происхождению») — науки о происхождении жизни, в центре внимания которой вот уже более 50 лет находится молекула ДНК.

Открытие, которое перевернуло мир

«Мы только что открыли секрет жизни!» — так 28 февраля 1953 года Френсис Крик и Джеймс Уотсон сообщили о своем открытии структуры ДНК. Что нового привнесло оно в науки о жизни? До этого было известно, что ДНК — большая молекула, в которой с помощью «четырехбуквенного алфавита» записана информация о строении и свойствах живых существ. Но оставалось непонятным, как эта информация передается из поколения в поколение и материализуется в эти самые структуры и свойства, а также какова пространственная структура ДНК.

Разгадка структуры ДНК помогла ученым понять механизмы ее копирования и материализации. ДНК состоит из двух цепей, которые комплементарны (дополнительны) друг другу. Копирование ДНК происходит за счет достраивания на каждой исходной цепи ДНК, как на матрице, дополнительной к ней копии. Так из одной двойной спирали ДНК получаются две абсолютно идентичные ей двойные спирали, что и необходимо для сохранения генетической информации при делении материнской клетки на две дочерние. Матричный принцип лежит также в основе поэтапной материализации генетической информации: на одной из цепей ДНК образуется комплементарная ей цепь другой информационной молекулы — РНК, которая, в свою очередь, служит матрицей для синтеза белков, от количества и качества которых зависят структуры и свойства конкретного организма.

Насколько это открытие значимо для постижения тайны жизни? С одной стороны, знания структуры ДНК явно недостаточно для того, чтобы ответить на вопрос «что такое жизнь?». Но с другой — именно это открытие сделало «научным» очень древний и очень важный вопрос о взаимосвязи потенциального и проявленного — на примере связи информации о структурах и свойствах организма с самими структурами и свойствами. И не только поставило этот вопрос, но и дало ключ к ответу на него. Этот ключ — матричный принцип, принцип комплементарности.

Путь от гена до признакаЧто означает классическая фраза из учебника: «ДНК — носитель генетической информации»? Как генетическая информация связана со структурой ДНК? Каким образом информация воплощается в конкретных свойствах организма? Если за точку отсчета генетической информации принять структуру ДНК и далее следовать структурной модели, то путь от гена до признака будет выглядеть так: в последовательности ДНК зашифрованы все свойства организма; линейная структура конкретного гена однозначно определяет линейную структуру соответствующего ему белка, которая, в свою очередь, однозначно определяет роль этого белка в формировании того или иного признака. Другими словами, «ДНК рождает РНК; РНК рождает белок, а белок рождает нас с вами» (Ф. Крик). Если это верно, то для того, чтобы изменить тот или иной признак (например, вылечить болезнь, имеющую генетические корни), достаточно установить соответствующую ему последовательность участка ДНК и исправить ее. Но так ли все просто? Достаточно ли знаний (хотя они бесспорно верны и необходимы!) о структурных соответствиях на пути от гена к признаку, для того чтобы понять и воспроизвести этот путь?

Последние достижения генетики показали, что недостаточны. В 2003 году в рамках проекта «Геном человека» была полностью определена линейная структура ДНК человека (и многих других простых и сложных организмов). Как сказал один из ученых, «прочитаны все буквы, которыми написана толстая книга, теперь еще понять бы слова и их смысл». Выяснилось, что собственно генов (участков ДНК, кодирующих белки) у человека около 30 000, и это лишь 1–3% всей ДНК! Столько же генов у растения Arabidopsis taliana и рыбы фугу. Более того, 99% генов человека совпадают с генами мыши, то есть человек имеет всего 300 генов, которых нет у мыши. (Трудно представить, что у нас и мышей одинаковы еще и 99% признаков!)

Дальше — больше. Оказалось, что однозначная взаимосвязь между геном и белком существует только у бактерий. А у человека возможно образование многих белков на основании одного гена (максимально известное сегодня число разных белков, кодируемых одним геном, — 40 000!) и возникновение многих функций у одного белка. Получается, что путь от потенциального к проявленному, от генетической информации к признаку отнюдь не линейный; что каждый признак является результатом сложных взаимодействий многих генов и их продуктов-белков; что само понятие «ген» из-за своей неоднозначности вряд ли может служить «отправным пунктом» этого пути.

Взаимодействие структурТело человека состоит из 10 в 14-ой степени клеток. Все они имеют абсолютно одинаковую ДНК, но существенно различаются по форме, размерам и своим задачам. Разрешение этого парадокса — в избирательном считывании генетической информации. В каждой клетке активными являются только те гены, которые ей в данный момент необходимы. Избирательность обеспечивают специальные гены-регуляторы, которые разрешают или запрещают считывание информации с того или иного участка ДНК. Активность гена зависит и от его окружения в пространстве клеточного ядра. Смена окружения, вызванная перемещением самого гена или кого-то из его соседей, способна изменить его активность («выключить» или «включить» ген). Например, в геноме человека есть масса потенциально опасных вирусных генов и протоонкогенов (способных вызвать раковое перерождение клетки). Они могут долгое время (и всю жизнь) вести себя вполне мирно и даже работать на благо клетки, до тех пор пока перемещение их самих или кого-то из окружения не выявит в этих генах агрессивные потенциалы. К счастью, могут произойти другие перемещения, которые утихомирят «бунтовщика» или включат защитные механизмы.

Итак, носитель генетической информации переместился с уровня гена (конкретного участка ДНК) на эпигенетический (от латинского «над», «сверх») уровень взаимодействия генов между собой и с другими структурами ядра клетки (99% негенной ДНК и белками). Предположим, наука расшифрует механизм этого взаимодействия. Приведет ли это к раскрытию тайны жизни? Жизнь — это только лишь структура? А если нет, стоит ли в поисках разгадки тайны жизни ограничиваться взаимодействием структур?

Кто сторожит сторожа?Как из единственной клетки в результате 46 делений получается не бесформенная масса из 1014 клеток, а весьма характерное тело каждого из нас? Последовательно удваиваясь, клетки не только сами становятся разными, но еще и формируют разные части тела в нужное время и в нужном месте. Что управляет организацией клеток во времени и пространстве? Целое, которое качественно больше простой суммы составляющих его частей-клеток. И это не противоречит тому, что организм образуется из одной клетки, — вопрос в том, что для этой клетки воплощает «волю целого». Поиски подобного упорядочивающего фактора вылились в начале XX века в концепцию морфогенетического поля. Ее основоположником стал русский ученый А.Г. Гурвич. Когда Гурвич работал над теорией поля, молекула ДНК считалась составной частью хромосом, и ей не придавали особого значения. В 1944 году ученый опубликовал свой труд «Теория биологического поля». Этот год стал судьбоносным для всей генетики, определив путь ее развития на несколько десятилетий вперед. В центре внимания ученых оказалась молекула ДНК, поскольку было доказано, что именно ей принадлежит ведущая роль в передаче наследственной информации. Не за горами был и 1953-й… В результате все свое внимание наука сосредоточила на структуре ДНК, которую фактически стала отождествлять с переносимой ею информацией, а теория биологического поля оказалась не в почете. Но исследования в этой области продолжались, и все эти годы два пути познания тайны жизни шли параллельно…

Переход в новое тысячелетие изменил соотношение сил в науках о жизни. Все больше ученых приходят к тому, что структурный ключ в познании живого необходим, но недостаточен; что разные подходы не исключают друг друга, а образуют объединенный путь научного поиска; что по сути своей структурный подход и теория поля комплементарны. Вспомним: именно предположение о комплементарности цепей ДНК стало ключом к расшифровке ее структуры, а само открытие 1953 года оказалось возможным благодаря комплементарности усилий представителей разных областей науки — физиков, химиков, биологов. Может быть, объединенная наука нового тысячелетия не только окончательно примирит разные научные подходы (например, структурный и полевой), но и обратится к плодам «ненаучного» пути познания тайны жизни — тысячелетней мудрости человечества, — «ненаучного», поскольку этот путь уходит корнями в те времена, когда науки не было и в помине. Обращение к источникам древней мудрости способно дать науке ключи от двери, за которой скрыта тайна. Но чтобы это произошло, столь разные пути познания должны где-то «пересечься». Одним из таких «перекрестков» может стать концепция формообразующего поля (биологического, морфогенетического, информационного), выросшая на почве современной науки и восходящая к явлениям, рассматривавшимся в древних источниках. Последние говорят о том, что человек состоит из нескольких тел, или принципов, которые не являются отдельными, независимыми частями, а взаимопроникают и взаимоформируют друг друга; что видимое, плотное, физическое тело является проводником, носителем более тонкоматериальных тел, которые с его помощью проявляются в физическом мире и взаимодействуют с ним; что «сборкой» — формированием физического тела из элементов физической материи — управляет самое «плотное» из этих тел, астральное тело-прообраз (план, матрица).

Современная наука знает, что каждая вновь образовавшаяся клетка участвует в формировании организма согласно индивидуальной «инструкции» (активные, или включенные, гены) и что у родителя и у потомков этой клетки могут быть совсем другие «инструкции». Но что и как согласует переключения индивидуальных «программ» развития миллиардов клеток, пока не ясно. Теория биологического поля предполагает, что согласование есть функция целого, которое и является тем самым полем, матрицей или моделью; что каждая вновь образовавшаяся клетка с помощью собственного генетического аппарата подключается к единому «плану» развития организма, получает оттуда индивидуальные «инструкции» и реализует их в рамках собственной программы поведения. Получается, что генетический аппарат клетки состоит, как минимум, из трех функциональных блоков: воспринимающей «антенны», «пульта управления» активностью генов и «исполнительной» части — генов, ответственных за образование конкретных белков. Вспомним, что на долю генов приходится всего 1–2% от всей клеточной ДНК. В оставшихся 98–99% ДНК уже обнаружены структуры, относящиеся ко второму «управляющему блоку». А что играет роль «антенны»? Где происходит «встреча двух миров» — информационного поля и генетических структур, воплощающих эту информацию в конкретное физическое тело?

Мост от потенциального к проявленномуПочему бы не предположить, что роль антенны, способной улавливать, трансформировать и передавать сигналы волновой природы, тоже играет ДНК? К этому располагает и спиральная структура «молекулы жизни» (многие технические антенны имеют форму спирали), и такие ее свойства, как способность проводить электрический ток, возможность резонансного возбуждения продольных колебаний под действием радиоволн, а также способность к лазерной генерации света после предварительной «накачки».

Если ДНК может работать на прием информации, обеспечивающей жизненную активность клеток, то ей вовсе не обязательно постоянно хранить эту информацию в своей структуре. Как, например, мозгу человека, чтобы успешно управлять системами жизнеобеспечения организма, не обязательно быть «вместилищем» разума, а достаточно играть роль посредника между сознанием и телом: он воспринимает информацию из плана сознания и «переводит» ее на язык управления телом.

И ясно, почему в случае повреждений структуры ДНК (или мозговых структур) страдает физическое тело. Ведь всем известно, что при неисправности в телевизоре хотя бы одной детали изображение на его экране сильно искажается, а если телевизор лишить антенны или выключить его из сети, на экране вообще ничего не появится.

ДНК — связующее звено между «моделью» физического тела и ее конкретным воплощением. Мозг — посредник между разумом и телом. Разум связывает жизнь и форму ее проявления и позволяет жизни, заключенной в форме, познавать саму себя. С помощью этого замечательного инструмента человек имеет возможность изучать окружающий мир и находить в нем ключи к познанию своего внутреннего мира. Так рождается объединенный путь, ведущий к познанию тайны жизни. Ибо человек есть величайшая из тайн — тайна взаимосвязи земли и неба.

gkb4.com

Глава 2. ДНК. Лестница жизни [Десять величайших изобретений эволюции]

На стене паба “Орел” в Кембридже висит синяя мемориальная доска, установленная в 2003 году в честь пятидесятилетия одного случая, когда разговоры в этом пабе приняли не совсем обычный оборот. Во время обеда 28 февраля 1953 года два завсегдатая “Орла”, Джеймс Уотсон и Фрэнсис Крик, пришли туда и объявили, что раскрыли тайну жизни. Хотя этот эмоциональный американец и этот разговорчивый британец, отличавшийся малоприятным смехом, временами, должно быть, и напоминали дуэт комиков, на сей раз они были абсолютно серьезны — и наполовину правы. Если считать, что у жизни есть тайна, то эту тайну, несомненно, составляет именно ДНК. Впрочем, Крик и Уотсон, при всех их незаурядных способностях, раскрыли тогда лишь половину этой тайны.

В то утро они разгадали структуру ДНК — двойную спираль. Полученная ими схема стала результатом вдохновенного интеллектуального прорыва, обеспеченного гениальностью, умением строить модели, знанием химии и несколькими позаимствованными без спроса рентгенограммами, и была, по словам Уотсона, “слишком хороша, чтобы быть неправдой”. И чем больше они говорили о ней в тот обеденный перерыв, тем больше убеждались в ее правильности. Она была опубликована в номере журнала “Нейчур” от 25 апреля в письме, которое заняло всего одну страницу и немного напоминало заметку о появлении новорожденного в малотиражной местной газете. Необычайно скромная по тону (Уотсон писал в своей знаменитой книге, что “никогда не видел, чтобы Фрэнсис Крик держался скромно”, да и сам он был не намного скромнее своего партнера), та заметка завершалась намеренно уклончивым утверждением: “От нашего внимания не ускользнуло, что постулированное нами специфическое образование пар заставляет сразу предположить возможный механизм копирования генетического материала”.

ДНК, как известно, составляет основу наших генов, наследственный материал клеток. В ней зашифрованы свойства людей и амеб, грибов и бактерий — всех форм жизни на нашей планете, за исключением некоторых вирусов. Двойная спираль ДНК, в которой две цепочки без конца вьются друг вокруг друга оборот за оборотом, — поистине культовый научный символ. Уотсон и Крик показали, как одна цепочка дополняет другую на молекулярном уровне. Если оторвать их друг от друга, каждая из них может служить матрицей для воссоздания другой, так что из одной спирали получатся две точно таких же. Всякий раз, когда тот или иной организм размножается, он передает копии своей ДНК потомкам. Все, что для этого нужно, — это разделить цепочки и синтезировать две идентичных копии оригинала.

Хотя подробное описание молекулярного механизма этого процесса могло бы вызвать у любого читателя головную боль, лежащий в основе механизма принцип изумительно, потрясающе прост. Генетический код представляет собой последовательность “букв” (их более строгое наименование — “азотистые основания”). Таких букв в ДНК-алфавите всего четыре: А, Т, Г и Ц. Их полные названия — аденин, тимин, гуанин и цитозин, но эти химические термины для нас здесь не важны. Важно то, что в связи с ограничениями, накладываемыми формой молекул ДНК и структурой связей в них, А может образовывать пару только с Т, а Ц — только с Г. Если оторвать цепочки двойной спирали одну от другой, на каждой из них будут рядком торчать неспаренные буквы. С каждой буквой А может связаться только Т, а с каждой буквой Ц — только Г, и так далее. Азотистые основания не только дополняют друг друга, но и испытывают настоящую потребность найти себе пару. Только одно может сделать тусклую химическую жизнь буквы Т светлее — постоянная близость с буквой А. Стоит их совместить, и все их связи запоют в чудесной гармонии. Это химическое явление — настоящий “основной инстинкт”, неотъемлемое свойство азотистых оснований. Оно делает из цепочек ДНК нечто большее, чем пассивные матрицы: каждое основание обладает своего рода магнетизмом, притяжением к своему “альтер эго”. Стоит разделить цепочки, и они самопроизвольно сольются снова или, если им помешать, смогут послужить матрицами, обладающими неодолимой тягой к соединению с другой “второй половиной”, неотличимой от прежней.

Схема соединения азотистых оснований ДНК. Геометрическими особенностями “букв" определяется, что Г связывается только с Ц, а А — только с Т.

Последовательность букв ДНК кажется нескончаемой. Например, в человеческом геноме почти три миллиарда пар азотистых оснований (на научном языке — три гигабазы). Это значит, что если взять по одной из всех хромосом, имеющихся в ядре нашей клетки, общее число букв в них составит почти три миллиарда. Если опубликовать последовательность человеческого генома в виде книг, она заполнит примерно двести томов размером с солидный телефонный справочник. А ведь наш геном — еще далеко не самый большой. Как ни странно, рекордсменом по этому показателю является ничтожная амеба Amoeba dubia, гигантский геном которой содержит 670 гигабаз — примерно в 220 раз больше, чем в нашем геноме. По большей части он, судя по всему, состоит из “мусора” — ДНК-последовательностей, которые вообще ничего не кодируют.

Каждому делению клетки предшествует удвоение (репликация) всей ее ДНК — процесс, занимающий не один час. Человеческое тело состоит из чудовищного количества клеток — пятнадцати миллионов миллионов, и в каждой из них содержится собственная высококачественная копия (на самом деле — даже две копии) одних и тех же молекул ДНК. Чтобы организм каждого из нас развился из единственной оплодотворенной яйцеклетки, двойным спиралям нашей ДНК пришлось разделяться и служить матрицами для достраивания новых цепочек пятнадцать миллионов миллионов раз (и даже гораздо больше, потому что наши клетки все время умирают и замещаются новыми). Точность копирования каждой буквы фантастична: ошибки в их порядке встречаются с частотой всего в один случай на миллиард букв. Для сравнения: переписчику книг, чтобы работать со сходной точностью, понадобилось бы 280 раз переписать всю Библию от начала до конца, прежде чем сделать единственную ошибку. На деле переписчики справлялись со своей работой далеко не столь успешно. Утверждается, что до нашего времени дошло около 24 тысяч рукописных экземпляров Нового Завета, и среди них нет двух одинаковых.

И все же ошибки накапливаются и в ДНК — хотя бы потому, что геном так огромен. Ошибки, при которых одна буква случайно заменяется другой, называют точечными мутациями. Перед каждым делением человеческой клетки можно ожидать появления в каждом наборе хромосом примерно трех подобных мутаций. И чем дольше клетка делится, тем больше в ней накапливается мутаций (это может приводить к развитию болезней, например рака). Мутации могут также передаваться из поколения в поколение. Если из оплодотворенной яйцеклетки развивается женский зародыш, то яйцеклетки нового организма образуются после примерно тридцати циклов деления, и в ходе каждого цикла добавляются новые мутации. У мужского организма дела обстоят еще хуже: для образования сперматозоидов требуется около ста циклов деления, каждый из которых неизбежно вносит свою лепту в груз мутаций. Поскольку производство сперматозоидов продолжается на протяжении всей жизни и включает все больше и больше клеточных циклов, то чем старше мужчина, тем больше мутаций накапливается в его половых клетках. Генетик Джеймс Кроу сформулировал эту закономерность так: наибольшая мутационная угроза здоровью человеческих популяций исходит от плодовитых стариков. Но даже у среднего ребенка молодых родителей имеется около двухсот новых мутаций, которые у них самих отсутствовали (хотя лишь немногие из этих мутаций могут оказаться вредными)1.

Поэтому, несмотря на необычайную точность копирования ДНК, ее молекулы все-таки меняются. Каждое поколение отличается от предыдущего — не только оттого, что в результате полового процесса гены перемешиваются, но также оттого, что каждый из нас становится носителем новых мутаций. Многие из них представляют собой точечные мутации, о которых мы говорили выше (изменения единственной буквы ДНК), другие бывают намного радикальнее. Порой целые хромосомы лишний раз удваиваются или не могут разойтись при делении клетки, длиннейшие куски ДНК удаляются, вирусы встраивают в хромосомы свою ДНК, а фрагменты хромосом переворачиваются так, что последовательность букв меняется на противоположную. Возможностей таких изменений бесконечно много, хотя наиболее серьезные из них обычно несовместимы с жизнью. Если рассмотреть наш геном на этом уровне, он окажется похожим на яму, кишащую змеями, где змееподобные хромосомы без устали сливаются и разделяются. Роль стабилизирующей силы здесь играет естественный отбор, отсеивающий рождающихся монстров, кроме самых безобидных. ДНК причудливо извивается и меняется, но отбор ее выпрямляет и исправляет. Любые полезные изменения сохраняются, а любые серьезные ошибки или особо вредные изменения приводят к выкидышу — в буквальном смысле. Из вредных мутаций сразу не отсеиваются лишь не столь серьезные, которые могут быть связаны с болезнями, проявляющимися на более поздних этапах жизни.

Меняющиеся последовательности букв в ДНК стоят почти за всем, что можно прочитать в газетах о наших генах. Например, ДНК-дактилоскопия (которую используют для установления отцовства, импичмента президентов, а также уличения преступников — иногда спустя десятки лет после события преступления) основана на различиях в последовательностях ДНК-букв между индивидуумами. Человеческие геномы различаются столь заметно, что ДНК каждого из нас свойственны собственные уникальные “отпечатки”. Степень нашей подверженности многим болезням тоже зависит от крошечных различий в ДНК-последовательностях. В среднем люди отличаются друг от друга примерно одной на каждую тысячу букв, так что разница между двумя человеческими геномами составляет 6-ю миллионов однобуквенных отличий — так называемых “снипов” (SNPs, от single nucleotide polymorphisms — однонуклеотидные полиморфизмы). Существование снипов означает, что у всех нас имеются немного разные варианты большинства генов. Хотя большинство снипов почти точно не имеют для нас никаких последствий, некоторые из них связаны с недугами, такими как диабет или болезнь Альцгеймера (однако как они действуют, нам еще не всегда известно).

При всех этих различиях мы все-таки можем пользоваться понятием “человеческий геном”: несмотря на все снипы, 999 букв из каждой тысячи у всех нас все-таки совпадают. На то есть две причины: время и отбор. В эволюционных масштабах не так уж много времени прошло с тех пор, как мы были обезьянами. Более того, зоолог стал бы уверять вас, что мы по-прежнему обезьяны. Предки человека отделились от общего предка с шимпанзе около шести миллионов лет назад и с тех пор накапливали мутации с частотой двести мутаций за поколение. Этого времени хватило лишь на то, чтобы изменить около 1 % нашего генома. При этом предки шимпанзе эволюционировали со сходной скоростью, и теоретически мы могли бы ожидать разницы в 2 %. Но на деле разница несколько меньше: ДНК-последовательности людей и шимпанзе идентичны на 98,6 %2. Это связано с постоянным торможением изменений, которое обеспечивает естественный отбор, выбраковывая большинство вредных мутаций. Ясно, что когда многие изменения выбраковываются отбором, оставшиеся будут больше похожи друг на друга, чем были бы, если бы их ничто не сдерживало.

Если углубиться еще дальше в прошлое, мы увидим, как эти две силы, время и отбор, действуя вместе, сплели великолепнейший, изысканнейший ковер. Все живое на нашей планете состоит в родстве, и, читая буквы ДНК, можно выяснить, в каком. Сравнивая ДНК-последовательности, можно рассчитать степень нашего родства с любыми другими организмами, от обезьян до сумчатых, рептилий, амфибий, рыб, насекомых, ракообразных, червей, растений, простейших, бактерий — кого угодно. Свойства всех нас определяются последовательностями букв, которые можно точными методами сравнивать друг с другом. У всех нас даже есть общие участки последовательностей — фрагменты, изменение которых сдерживалось общими механизмами отбора, в то время как другие участки изменялись до неузнаваемости. Если прочитать ДНК-последовательность кролика, мы увидим такие же нескончаемые ряды оснований, одни участки которых будут идентичны нашим, другие — отличными от них, и все они будут перемешаны друг с другом, составляя сложный калейдоскоп. То же относится и к чертополоху: кое-где наши с ним ДНК-последовательности идентичны или похожи, но здесь несходные участки будут занимать гораздо больше места, отражая, во-первых, огромный промежуток времени, прошедшего с тех пор, когда жил наш общий предок, а во-вторых, разность образа жизни человека и чертополоха. Впрочем, глубокие основы нашей биохимии остались теми же. Мы все состоим из клеток, работающих сходным образом, и их общие свойства определяются похожими участками ДНК-последовательностей.

Учитывая эти черты глубокого биохимического сходства, можно ожидать, что у нас найдутся общие участки последовательностей даже с самыми далекими от нас формами жизни, такими как бактерии. Это действительно так. Но здесь мы сталкиваемся с источником некоторой путаницы, поскольку сходство последовательностей может оцениваться не в пределах 0-100%, а лишь от 25 до 100% (ведь ДНК-букв всего четыре). Если случайным образом заменить одну букву на одну из четырех, с вероятностью 25% новая буква будет такой же, как и старая. Точно так же, если с нуля синтезировать в лаборатории случайную ДНК-последовательность, она неизбежно будет по крайней мере на четверть сходна с любым случайно выбранным нашим геном. Поэтому соображение о том, что мы “наполовину бананы”, раз наш геном наполовину совпадает с геномом банана, мягко говоря, неверно. Исходя из той же логики, любая случайно составленная последовательность ДНК будет на четверть человеком. Не зная, что именно означают буквы той или иной последовательности, мы блуждали бы впотьмах.

Именно поэтому утром 28 февраля 1953 года Уотсон и Крик лишь наполовину разгадали загадку жизни. Им удалось разобраться в строении ДНК и понять, как каждая из двух цепочек двойной спирали служит матрицей для синтеза копии другой цепочки, обеспечивая передачу наследственного кода каждого организма. О чем они не упомянули в своей знаменитой статье (поскольку для выяснения этого потребовался еще десяток лет хитроумных исследований), — так это о том, как именно в каждой последовательности букв зашифрована наследственная информация. Хотя расшифровка генетического кода, этого шифра жизни, и не дала столь символичного и впечатляющего результата, как сама двойная спираль, ровным счетом ничего не говорящая о последовательностях записанных в ней букв, она стала, возможно, еще более крупным достижением — в тем числе Фрэнсиса Крика, сыгравшего в тех исследованиях немалую роль. Для темы этой главы особенно важно, что расшифрованный код, сначала казавшийся главным разочарованием современной биологии, сообщает нам интереснейшие сведения о становлении в ходе эволюции самой ДНК почти четыре миллиарда лет назад.

Схема двойной спирали молекулы ДНК, показывающая, как две ее цепочки закручиваются друг вокруг друга. Если разделить их, каждая цепочка сможет служить матрицей для синтеза точно такой же противоположной цепочки.

ДНК кажется чем-то столь современным, что нам сложно оценить, как мало в 1953 году было известно о началах молекулярной биологии. Образ двойной спирали разошелся по свету именно из той публикации Уотсона и Крика, иллюстрацию к которой нарисовала жена Крика Одиль (она была художницей). На ее рисунке ДНК похожа на своего рода винтовую лестницу, и именно так его и воспроизводили почти без изменений на протяжении полувека. Написанная в 60-х годах знаменитая книга Уотсона “Двойная спираль” стала, в свою очередь, классическим изображением современного взгляда на науку. Влияние этой книги было настолько велико, что сама жизнь, может быть, начала подражать искусству. Я, например, прочитав “Двойную спираль” еще в школе, и сам стал мечтать о Нобелевской премии и революционных открытиях. Думаю, мои представления о том, как занимаются наукой, в то время основывались почти исключительно на книге Уотсона, и разочарование, которое неизбежно постигло меня в университете, по всей вероятности, было связано с тем, что действительность не оправдала моих восторженных ожиданий. Я перестал искать острых ощущений в науке и занялся ради них скалолазанием. Потребовался не один год, чтобы я снова проникся чувством интеллектуального восторга от научной работы.

Но едва ли не все, чему я научился в университете, было неизвестно в 1953 году Уотсону и Крику. Давно стал общим местом тезис, что “белки закодированы в генах”. Но в начале 50-х годов даже по этому вопросу у ученых не было единого мнения. Уотсон впервые приехал в Кембридж в 1951 году, и очень скоро его стал раздражать скептицизм Макса Перуца и Джона Кендрю. По их мнению, еще нельзя было считать окончательно доказанным, что гены записаны в ДНК, а не в белках. Хотя молекулярная структура ДНК не была пока известна, ее химический состав был уже вполне ясен, и было известно, что он почти не меняется от одного вида к другому. Если гены действительно составляют основу наследственности и в них закодированы бесчисленные отличительные черты разных особей и видов, то как можно было пытаться объяснить все богатство и разнообразие жизни этим однородным соединением, по составу которого даже животные и бактерии не слишком отличаются друг от друга? Казалось, что белки с их бесконечным многообразием гораздо лучше подходят на роль носителя наследственной информации.

Уотсон был одним из тех немногих, кого убедили результаты экспериментов американского биохимика Освальда Эвери, опубликованные в 1944 году и свидетельствовавшие о том, что гены записаны в ДНК. Только энтузиазм и убежденность Уотсона побудили Крика взяться за насущную проблему разгадки структуры ДНК. Когда эта проблема была решена, ребром встал вопрос о генетическом коде. И здесь степень неосведомленности ученых того времени тоже просто удивительна для людей нового поколения. Молекулы ДНК состоят из последовательностей, составленных из всего четырех букв, расположенных на первый взгляд в случайном порядке. Было не так уж сложно догадаться, что этот порядок должен каким-то образом кодировать белки. Молекулы белков тоже состоят из последовательности “строительных блоков”, которые называют аминокислотами. Последовательностями букв в ДНК были предположительно закодированы последовательности аминокислот в белках. Но если код был универсальным для всех организмов (чего на тот момент уже можно было ожидать), то набор аминокислот, входящих в состав белков, тоже должен был оказаться универсальным. А в этом еще отнюдь не было уверенности. Саму эту возможность мало кто обсуждал, пока Уотсон и Крик за обедом все в том же “Орле” не составили канонический список двадцати аминокислот, который сейчас можно найти во всех учебниках. Любопытно, что хотя ни один из дуэта не был биохимиком, они угадали все с первого же раза.

Теперь задача сразу стала ясна. Все свелось к математической головоломке, варианты решения которой не ограничивались никакими фактами из тех, что пришлось зубрить следующим поколениям студентов, изучавших молекулярную биологию. Четыре буквы в молекулах ДНК должны были кодировать двадцать аминокислот. Это позволяло отбросить возможность прямой транслитерации, при которой одна ДНК-буква соответствовала бы одной аминокислоте. Дублетный код тоже был невозможен, потому что кодировал бы не более шестнадцати аминокислот (4x4 = 16). Минимальное число букв было три, то есть код мог быть триплетным (впоследствии Фрэнсис Крик и Сидней Бреннер доказали, что это именно так). Каждая группа из трех ДНК-букв могла кодировать одну аминокислоту. Но такой код казался очень уж расточительным. Из четырех букв можно составить шестьдесят четыре триплета (4x4x4 = 64), а значит, потенциально триплетами можно было закодировать шестьдесят четыре аминокислоты. Так почему же их было только двадцать? Секрет этого фокуса должен был объяснить смысл четырехбуквенного “алфавита”, организованного в шестьдесят четыре трехбуквенных “слова”, кодирующие двадцать аминокислот.

Не случайно, наверное, первым, кому удалось дать хоть какой-то ответ, стал не биолог, а энергичный американский физик российского происхождения Георгий (Джордж) Гамов, больше известный своими теориями, касающимися Большого взрыва. Гамов считал ДНК в буквальном смысле матрицей для синтеза белков. Он полагал, что аминокислоты вкладываются в ромбовидные борозды между оборотами спирали. Но его теория генетического кода была в основе нумерологической, и когда он узнал, что белки вообще не синтезируются в ядре, а значит, в ходе синтеза не могут непосредственно контактировать с ДНК, это не произвело на него особого впечатления. Этот факт лишь делал его идею более абстрактной. Суть его предположения состояла в том, что код перекрывается. Это дает большое преимущество, которое обожают криптографы: максимизация плотности информации. Представьте себе последовательность АТЦГТЦ. Первое слово, или, если использовать более строгий термин, первый кодон, будет АТЦ, второй — ТЦГ, третий — ЦГТ, и так далее. Здесь важно то, что перекрывающиеся кодоны всегда ограничивали бы число аминокислотных последовательностей. Например, если АТЦ кодирует определенную аминокислоту, за ней может следовать только аминокислота, кодон которой начинается с букв ТЦ, а следующей аминокислоте должен соответствовать кодон, начинающийся с буквы Ц. Если изучить все возможные варианты, окажется, что очень многие триплеты просто недопустимы: они не могут входить в состав этого перекрывающегося кода, потому что в нем буква А всегда должна стоять рядом с Т, Т — рядом с Ц, и так далее. И сколько триплетов у нас останется для кодирования аминокислот? Ровно двадцать! — сказал Гамов с торжеством фокусника, вынимающего кролика из шляпы.

Эта остроумная идея была первой из многих, безжалостно опровергнутых фактами. Перекрывающиеся коды оказались невозможны из-за накладываемых ими самими ограничений. Во-первых, они предполагают, что некоторые аминокислоты в белках должны всегда стоять рядом. Но Фред Сэнгер, скромный гений, впоследствии получивший две Нобелевских премии (одну за метод прочтения последовательностей аминокислот в белках, другую — за метод прочтения букв в ДНК), занимался в то время выяснением последовательности аминокислот в молекуле инсулина. Вскоре он выяснил, что аминокислоты в белке могут располагаться в любом порядке и ограничений на их последовательности в белках в природе нет. Вторая серьезная проблема состояла в том, что при перекрывающемся коде любая точечная мутация (в которой одна буква заменяется другой) неизбежно приводила бы к изменению больше чем одной аминокислоты в белке, а экспериментальные данные свидетельствовали о том, что при таких мутациях меняется лишь одна аминокислота. Стало ясно, что генетический код не перекрывается. Предположение Гамова о перекрывании кода было опровергнуто задолго до того, как стал известен настоящий код. Криптографы начали подозревать, что мать-природа упустила возможность воспользоваться некоторыми известными им трюками.

Следующую попытку разгадать загадку кода предпринял Крик. Он высказал идею настолько красивую, что ее немедленно все приняли, хотя самого автора и смущала нехватка доказательств. Крик воспользовался новыми открытиями, сделанными в нескольких молекулярно-биологических лабораториях, в первую очередь в новой лаборатории Уотсона в Гарварде. Уотсон глубоко увлекся исследованиями РНК — более короткой одноцепочечной молекулы, близкой к ДНК и находимой как в цитоплазме клеток, так и в ядре. Кроме того, он обратил внимание на то, что РНК составляет неотъемлемую часть крошечных структур, теперь называемых рибосомами, на которых, судя по всему, и синтезировались белки. Итак, неактивная ДНК сидит в ядре. Когда нужно синтезировать какой-либо белок, соответствующий участок ДНК используется в качестве матрицы, чтобы синтезировать его РНК-копию. Она физически выходит из ядра и достигает ожидающих ее снаружи рибосом, синтезирующих этот белок, используя в качестве матрицы уже молекулу РНК. Эта разновидность РНК впоследствии получила название матричной РНК (мРНК). Уотсон еще в 1952 году писал Крику: “ДНК делает РНК делает белок”. Крика теперь интересовало вот что: как точная последовательность букв молекулы матричной РНК переводится (транслируется) в последовательность аминокислот в белке?

Крик крепко задумался. Он предположил, что матричная РНК транслируется с помощью набора особых молекул — адаптеров, по одной на каждую аминокислоту. Адаптеры тоже должны состоять из РНК, у каждого из них должен быть антикодон, способный узнавать соответствующий кодон матричной РНК и связываться с ним. Принцип этого связывания, как считал Крик, должен быть точно таким же, как в ДНК: Ц образует пару с Г, А — с Т, и так далее3. Существование адаптеров предполагалось тогда чисто гипотетически, но они действительно были открыты несколько лет спустя, и оказалось, что они действительно состоят из РНК, как и предсказывал Крик. Теперь их называют транспортными РНК (тРНК). Вырисовывалась система, напоминающая детский конструктор, детали которого соединялись друг с другом и вновь разделялись, образуя изумительные, хотя и недолговечные структуры.

Но здесь Крик пошел по ложному пути. Я пишу об этом довольно подробно потому, что хотя действительность и оказалась несколько богаче, чем он предполагал, его идеи могут по-прежнему быть актуальны для решения вопроса о том, как все это возникло. Крик представлял себе, что матричная РНК просто сидит в цитоплазме, а ее кодоны торчат, как соски свиноматки, и к каждому из них может “присосаться” транспортная РНК. Рано или поздно молекулы тРНК свяжутся с мРНК по всей длине, расположившись одна за другой, и с каждой из них будет связана, как хвост поросенка, соответствующая аминокислота, готовая соединиться с соседними аминокислотами и образовать белковую цепочку.

Проблема, по мнению Крика, состояла в том, что тРНК будут прибывать в случайном порядке, по мере их появления рядом с мРНК, и связываться с ближайшим соответствующим кодоном. Но если не начинать с начала и не заканчивать в конце, как они узнают, где начинается и где заканчивается один кодон? Как они смогут найти правильную рамку считывания? Если последовательность содержит фрагмент АТЦГТЦ, то одна тРНК может связаться с кодоном АТЦ, а другая — с кодоном ГТЦ, но что помешает соответствующей тРНК узнать кодон ЦГТ в середине этого фрагмента и тем самым транслировать совсем не то, что нужно? Предложенный Криком ответ на этот вопрос предполагал категорический запрет подобных вещей. Раз матрица в целом должна читаться однозначно, значит, не все кодоны должны иметь смысл. Какие же из них требовалось запретить? Ясно, что последовательности, состоящие только из А, только из Ц, только из Т или только из Г, должны были оказаться под запретом: в цепочке АААААА нельзя найти правильную рамку считывания. Затем Крик проверил все другие трехбуквенные комбинации. Он рассуждал примерно так: если АТЦ имеет смысл, то все циклические перестановки этих трех букв (ТЦА и ТАЦ) должны быть под запретом. Сколько возможностей это нам оставляет? Снова двадцать! (Из шестидесяти четырех возможных кодонов AAA, ТТТ, ЦЦЦ и ГГГ исключаются. Остается шестьдесят. Из каждых трех вариантов циклических перестановок допустим только один, значит, делим шестьдесят на три.)

В отличие от перекрывающихся кодов, код Крика не накладывал никаких ограничений на порядок аминокислот в белке и не предполагал, что точечная мутация будет непременно менять две или три аминокислоты. Когда была выдвинута эта гипотеза, казалось, она дает прекрасное решение проблемы рамки считывания и при этом сокращает число кодонов с шестидесяти четырех до двадцати, что соответствует числу аминокислот в белках. Эта гипотеза ничуть не противоречила всем имеющимся на тот момент данным. И все же она ошибочна. Спустя несколько лет выяснилось, что искусственно полученная РНК, состоящая из кодонов ААА (запрещенных Криком), все же кодирует аминокислоту лизин и может транслироваться в белковую цепочку, состоящую исключительно из лизина.

К середине 60-х годов, когда были усовершенствованы экспериментальные методы, нескольким исследовательским группам удалось шаг за шагом выяснить, что на самом деле представляет собой генетический код. После всех попыток расшифровать его открывшаяся картина вызывала глубочайшее разочарование. Оказалось, что никакого изящного нумерологического решения не было, а код просто вырожден (это значит, что в нем полно излишеств). Три аминокислоты кодируются шестью разными кодонами каждая, в то время как другие кодируются лишь одним или двумя. Все кодоны идут в дело: три кодона означают “стоп” (конец трансляции), а все остальные кодируют ту или иную аминокислоту. Выходило, что в генетическом коде нет никакого порядка, никакой красоты. Этот пример может служить нагляднейшим опровержением мысли, что красота может служить проводником к научной истине*1. Судя по всему, в основе кода не было и никакой структурной логики: между аминокислотами и соответствующими им кодонами не было ни особой химической, ни особой физической связи.

Крик объявил этот удручающий код “застывшей случайностью”, и большинство исследователей не могло с ним не согласиться. По мнению Крика, код застыл оттого, что любые покушения на его структуру (попытки его разморозить) имели бы слишком серьезные последствия. Единственная точечная мутация может изменить ту или иную аминокислоту, расположенную в определенном месте определенного белка, но любое изменение самого кода приводило бы к катастрофическим переменам во всех белках без исключения. Разница между этими событиями соответствовала бы разнице между случайной опечаткой в книге, не особенно меняющей ее смысл, и изменением одной буквы на другую во всем алфавите, что превращало бы весь текст в абракадабру. Поэтому, как считал Крик, после того, как код был выбит на скрижалях, любые покушения на него карались смертью. Эта точка зрения и сегодня широко распространена среди биологов.

Но предполагаемая Криком “случайная” природа кода ставила одну проблему. Почему такая случайность была всего одна? Почему не несколько? Если код произволен, то один код не должен быть особенно лучше другого. Не было никаких оснований считать, что отбор некогда создал своего рода “бутылочное горлышко”, при прохождении через которое один из вариантов кода обладал бы, по словам Крика, “таким селективным преимуществом над всеми конкурентами, что сохранился бы только он один”. Но если никакого “бутылочного горлышка” не было, то почему мы не наблюдаем сосуществования разных организмов с несколькими разными кодами? Крик всерьез задумался над этим вопросом.

Самый очевидный ответ предполагал, что все живое на земле происходит от общего предка, у которого генетический код уже был жестко закреплен. Говоря об этом в философском ключе, можно было сказать, что жизнь возникла на Земле лишь однажды, в связи с чем ее возникновение казалось событием уникальным и почти невероятным, может быть даже совершенно исключительным. По мнению Крика, это заставляло предположить заражение — однократное занесение жизни на нашу планету. Он стал отстаивать идею, что жизнь была “посеяна” на Земле в форме бактериальных клонов единственного внеземного организма. Крик пошел еще дальше: принялся доказывать, что эти бактерии были преднамеренно посеяны на Земле неким инопланетным разумом с помощью космического корабля. Крик назвал подобный сценарий “направленной панспермией”. Эту тему он разработал в книге “Жизнь как она есть”, опубликованной в 1981 году. Мэтт Ридли в своей превосходной биографии Крика писал: “Предмет этой книги вызвал немало удивления. Великий Крик пишет об инопланетных жизненных формах, рассеиваемых во Вселенной космическим кораблем? Не слишком ли успех вскружил ему голову?” Действительно ли идея случайного кода оправдывает столь далеко идущие философские выводы — вопрос спорный. Чтобы код прошел через “бутылочное горлышко”, не требуется, чтобы определенный его вариант имел какие-то особые преимущества перед другими. Сильный отбор по любому признаку, хотя бы и в результате исключительного события, например столкновения с Землей астероида, вполне мог истребить все живое на планете, кроме потомков единственного клона, которые по определению должны были обладать только одним вариантом кода. Так или иначе, Крик не вовремя выдвинул свою идею направленной панспермии. Как раз в начале 8о-х годов, когда он писал свою книгу, стало ясно, что генетический код нельзя считать ни застывшим, ни случайным. В нем есть скрытые закономерности, своего рода “код внутри кодонов”, дающий нам ключи к разгадке тайны происхождения нашего кода, возникшего почти четыре миллиарда лет назад. Теперь мы знаем, что он представляет собой не тот жалкий шифр, который так разочаровал в свое время криптографов, а единственный в своем роде код из миллиона возможных, способный противостоять изменениям и одновременно ускорять ход эволюции.

Код внутри кодонов! С 60-х годов в генетическом коде выявили целый ряд закономерностей, но большинство из них легко было отбросить как обыкновенный статистический шум (что, собственно, и делал Крик). Казалось даже, будто совокупность этих закономерностей не несет особого смысла. Хороший вопрос — почему так казалось. Этим вопросом задался калифорнийский биохимик Брайан Дэвис, уже давно интересовавшийся корнями генетического кода. Он отмечает, что сама идея “застывшей случайности” погасила интерес к проблеме происхождения кода. Какой смысл изучать происхождение случайности? Случайности случаются, только и всего. Кроме того, по мнению Дэвиса, те немногие исследователи, которые продолжали интересоваться этой проблемой, пошли по ложному пути, ухватившись за наиболее популярную в то время идею первичного бульона. Если генетический код возник в таком бульоне, то он должен восходить к молекулам, возникновение которых в результате происходивших в таком бульоне физических и химических процессов особенно вероятно. А это заставляло предположить, что в основе кода лежал некий базовый набор аминокислот, а все остальное добавилось позже. Истины в этой идее было ровно столько, чтобы данные, свидетельствующие в ее пользу, производили сильнейшее впечатление, хотя в действительности они лишь сбивали с толку. Смысл закономерностей генетического кода мы начинаем понимать лишь тогда, когда рассматриваем его как продукт биосинтеза, то есть продукт клеток, способных синтезировать собственные “строительные блоки” из водорода и углекислого газа.

Так что же собой представляют эти неочевидные закономерности? С каждой буквой триплетного кода связана некая закономерность. Особенно красноречивы свойства первой буквы, поскольку она касается процесса, позволяющего поэтапно превращать несложные вещества-предшественники в аминокислоты. Принцип, лежащий в основе этой закономерности, настолько поразителен, что его стоит здесь изложить в двух словах. В клетках современных организмов аминокислоты синтезируются посредством целого ряда биохимических преобразований, начинающихся с нескольких несложных веществ-предшественников. А удивительно здесь то, что между первой буквой триплетного кодона и этими несложными предшественниками есть определенная связь. Так, все аминокислоты, предшественником которых оказывается пируват, соответствуют кодонам, начинающимся с одной и той же буквы — в данном случае Т5. Я привел в качестве примера именно пируват, потому что мы уже встречались с этим веществом в главе 1. Оно может образовываться в гидротермальных источниках из углекислого газа и водорода при участии катализаторов — ими могут служить присутствующие в таких источниках минералы. Но это относится не только к пирувату. Предшественники всех аминокислот участвуют в цикле Кребса — основе биохимии всех клеток, и должны образовываться в щелочных гидротермальных источниках, которые мы обсуждали в главе 1. Напрашивается вывод (на данном этапе, надо признать, поверхностный, но нам еще предстоит его уточнить), что между первой буквой триплетного кода и гидротермальными источниками существует какая-то связь.

А как обстоят дела со второй буквой? Здесь наблюдается связь со степенью растворимости (или нерастворимости) аминокислоты в воде, то есть гидрофильности (или гидрофобности). Гидрофильные аминокислоты растворяются в воде, в то время как гидрофобные с ней не смешиваются, а растворяются в жироподобных веществах, таких как липидные мембраны клеток. Все аминокислоты можно распределить по своего рода спектру, начиная от “очень гидрофобных” и заканчивая “очень гидрофильными”. Именно этот спектр имеет связь со второй буквой триплетного кода. Пяти из шести самых гидрофобных аминокислот соответствуют кодоны с буквой Т в середине, а всем самым гидрофильным — кодоны с буквой А в середине. Промежуточным аминокислотам спектра соответствуют кодоны с буквой Г или Ц в середине. Таким образом, чем бы это ни объяснялось, в целом наблюдается сильная и вполне определенная связь между первыми двумя буквами каждого кодона и той аминокислотой, которую этот кодон кодирует.

Именно последняя буква приводит к вырожденности кода: восьми аминокислотам свойственна (прекрасный научный термин!) четырехкратная вырожденность. Хотя большинству читателей может показаться, что четырехкратная вырожденность означает совершенно опустившихся людей, пьяниц, которым удается падать в четыре разных канавы одновременно, биохимики обозначают этим термином ситуацию, когда третья буква кода не несет никакой информации. Независимо оттого, какое азотистое основание стоит на этом месте, во всех четырех случаях триплет кодирует одну и ту же аминокислоту. Например, в триплете ГГГ, кодирующем глицин, можно заменить последнюю Г на Т, А или Ц — и все три новых триплета будут по-прежнему кодировать глицин.

Вырожденность кода по третьей букве имеет несколько интересных следствий. Мы уже отмечали, что дублетный код мог бы кодировать только шестнадцать из двадцати входящих в состав белков аминокислот. Если исключить из их списка пять самых сложных (оставив, таким образом, пятнадцать, плюс стоп-кодон), закономерности, касающиеся первых двух букв, окажутся выражены еще ярче. Так что, возможно, код первоначально был дублетным и лишь потом расширился до триплетного в результате “присвоения кодонов”: аминокислоты могли соперничать друг с другом за третью букву. Древнейшие аминокислоты, вероятно, получили “нечестное” преимущество в борьбе за “прикарманивание” триплетных кодонов, и очень похоже, что так оно и было. Например, те пятнадцать аминокислот, которые скорее всего кодировались первоначальным дублетным кодом, загребли себе 53 из 64 возможных триплетов (в среднем 3,5 кодона на аминокислоту), в то время как оставшиеся пять “позднейших” аминокислот разделили между собой лишь восемь кодонов (в среднем 1,6 на аминокислоту). Очень похоже, что здесь кто успел, тот и съел.

Давайте подробно рассмотрим следующую возможность: код первоначально был дублетным, а не триплетным, и кодировал пятнадцать аминокислот (плюс один стоп-кодон). Этот первоначальный код, судя по всему, был почти полностью детерминирован, то есть продиктован физическими и химическими факторами. Есть немного исключений из того правила, что первая буква связана с предшественником, а вторая — с гидрофильностью или гидрофобностью аминокислоты. Здесь было мало простора для игры случая, не было свободы от физических законов.

Но с третьей буквой дело обстояло иначе. Здесь было куда больше возможных вариантов, и многое могло произойти по воле случая, после чего отбор получал возможность “оптимизировать” полученный код. Такое смелое предположение высказали в конце 90-х годов два английских специалиста по молекулярной биологии, Лоренс Херст и Стивен Фриленд. Эти два исследователя получили известность благодаря своей совместной работе по сравнению генетического кода с миллионами случайных кодов, сгенерированных компьютером. Они оценивали потенциальный вред точечных мутаций, при которых одна буква кодона заменяется другой. Исследователи задались вопросом, какой код лучше всего противостоял бы таким мутациям, либо по-прежнему кодируя все ту же аминокислоту, либо меняя ее на другую, похожую. Оказалось, что настоящий генетический код поразительно устойчив к таким изменениям: точечные мутации часто вообще не влияют на последовательность аминокислот, а если все-таки влияют, то аминокислота обычно заменяется на другую, близкую к исходной. Более того, Херст и Фриленд пришли к выводу, что наш генетический код лучше миллиона альтернативных кодов, сгенерированных случайным образом. Он оказался отнюдь не жалкой поделкой слепого шифровальщика, а уникальным продуктом, единственным из миллиона. Авторы этой работы утверждают, что наш код не только устойчив к потенциальным изменениям — он нейтрализует возможные катастрофические последствия тех изменений, которые все-таки происходят и тем самым ускоряют эволюцию. Ведь ясно, что у мутаций намного больше шансов оказаться полезными, если они не ведут к катастрофическим последствиям.

Не постулируя вмешательство божественного замысла, подобную оптимизацию можно объяснить только работой отбора. А если так, то шифр жизни должен был эволюционировать. И действительно, целый ряд незначительных вариаций этого “универсального” кода, наблюдаемых среди бактерий и митохондрий, говорит именно о том, что генетический код все-таки может эволюционировать — по крайней мере, при исключительных обстоятельствах. Но как, спросите вы вслед за Криком, он может меняться, не вызывая бедствий? Ответ: постепенно. Если аминокислота кодируется четырьмя или даже шестью разными кодонами, то некоторые из них могут использоваться чаще других. Редко используемые кодоны вполне реально передать другой (но, вероятно, близкой) аминокислоте, не вызывая катастрофических последствий. Именно так генетический код может эволюционировать.

Итак, в целом “код внутри кодонов” говорит нам о процессе, первоначально связанном с биосинтезом и водорастворимостью аминокислот, а затем проходившем фазы расширения и оптимизации. Возникает вопрос: что это был за процесс, на который начал действовать естественный отбор?

Точного ответа на этот вопрос нет, и несколько препятствий затрудняют его поиски. Одним из первых оказалась проблема ДНК и белков (напоминает давнюю проблему — что было раньше, курица или яйцо). Проблема в том, что ДНК сама по себе более или менее неактивна, так что даже для удвоения ее молекул требуются специальные белки. С другой стороны, специальные белки не могли стать специальными случайно. Они должны были эволюционировать путем естественного отбора, а для этого требовалось, чтобы их строение было, во-первых, наследуемым, а во-вторых, изменчивым. Белки не работают как наследуемая матрица для синтеза самих себя: их кодирует ДНК. Значит, белки не могут эволюционировать без ДНК, а ДНК не может эволюционировать без белков. А если одно не могло эволюционировать без другого, то отбору не с чего было начинать.

В середине 8о-х годов было сделано поразительное открытие. Выяснилось, что РНК может работать катализатором. РНК редко сворачивается в двойную спираль: она чаще существует в виде небольших молекул, образующих структуры сложной формы, способные выполнять каталитические функции. РНК позволяет разорвать порочный круг. В гипотетическом “мире РНК” она могла брать на себя роль как белков, так и ДНК, катализируя, наряду со многими другими реакциями, синтез самой себя. Вдруг оказалось, что генетический код поначалу мог вообще не иметь отношения к ДНК: он мог вырасти из непосредственных взаимодействий РНК с белками.

Все это выглядело вполне логично в свете того, что уже было известно о работе современных клеток. Теперь ДНК в клетках непосредственно с аминокислотами не взаимодействует, но многие из ключевых реакций, участвующих в синтезе белков, катализируются именно РНК-ферментами — так называемыми рибозимами. Термин “мир РНК” предложил Уолтер Гилберт, гарвардский коллега Уотсона, в одной из самых читаемых статей, когда-либо опубликованных в журнале “Нейчур”. Идея Гилберта произвела огромное впечатление на всех, кто занимался поисками истоков генетического кода. Изначальный его смысл, оказывается, состоял не в том, как ДНК кодирует белки, а в том, какого рода взаимодействия должны были происходить между РНК и аминокислотами. Однако ответ на поставленный вопрос был по-прежнему не очевиден.

Учитывая, какой интерес вызвала гипотеза мира РНК, может показаться странным, что мало кто обращал внимание на каталитические свойства маленьких фрагментов РНК. Если большие молекулы РНК могут катализировать различные реакции, вполне можно ожидать, что и совсем маленькие фрагменты РНК — отдельные “буквы” или пары “букв” — тоже могут катализировать какие-то реакции, хотя и не столь эффективно. Недавние исследования, которые совместно провели почтенный американский биохимик Гарольд Моровиц, специалист по молекулярной биологии Шелли Копли и физик Эрик Смит, указывают именно на эту возможность. Даже если идеи этих авторов и ошибочны, по-моему, именно такого рода теорию нам нужно искать, чтобы объяснить происхождение генетического кода.

Поделитесь на страничке

Следующая глава >

bio.wikireading.ru

Спираль ДНК. Лестница, ведущая в небо - Чего не знает современная наука (интересно о важном) - Сборник Статей - rutlib4.com

Спираль ДНК. Лестница, ведущая в небо

Что такое жизнь? Этот вопрос стал движущей силой развития генетики (от греческого genetikos – «относящийся к рождению, происхождению») – науки о происхождении жизни, в центре внимания которой вот уже более 50 лет находится молекула ДНК.

Открытие, которое перевернуло мир

«Мы только что открыли секрет жизни!» – так 28 февраля 1953 года Френсис Крик и Джеймс Уотсон сообщили о своем открытии структуры ДНК.

Что нового привнесло оно в науки о жизни? До этого было известно, что ДНК – большая молекула, в которой с помощью «четырехбуквенного алфавита» записана информация о строении и свойствах живых существ. Но оставалось непонятным, как эта информация передается из поколения в поколение и материализуется в эти самые структуры и свойства, а также какова пространственная структура ДНК.

Разгадка структуры ДНК помогла ученым понять механизмы ее копирования и материализации. ДНК состоит из двух цепей, которые комплементарны (дополнительны) друг другу. Копирование ДНК происходит за счет достраивания на каждой исходной цепи ДНК, как на матрице, дополнительной к ней копии. Так из одной двойной спирали ДНК получаются две абсолютно идентичные ей двойные спирали, что и необходимо для сохранения генетической информации при делении материнской клетки на две дочерние. Матричный принцип лежит также в основе поэтапной материализации генетической информации: на одной из цепей ДНК образуется комплементарная ей цепь другой информационной молекулы – РНК, которая, в свою очередь, служит матрицей для синтеза белков, от количества и качества которых зависят структуры и свойства конкретного организма.

Насколько это открытие значимо для постижения тайны жизни? С одной стороны, знания структуры ДНК явно недостаточно для того, чтобы ответить на вопрос «что такое жизнь?». Но с другой – именно это открытие сделало «научным» очень древний и очень важный вопрос о взаимосвязи потенциального и проявленного – на примере связи информации о структурах и свойствах организма с самими структурами и свойствами. И не только поставило этот вопрос, но и дало ключ к ответу на него. Этот ключ – матричный принцип, принцип комплементарности.

Путь от гена до признака

Что означает классическая фраза из учебника: «ДНК – носитель генетической информации»? Как генетическая информация связана со структурой ДНК? Каким образом информация воплощается в конкретных свойствах организма? Если за точку отсчета генетической информации принять структуру ДНК и далее следовать структурной модели, то путь от гена до признака будет выглядеть так: в последовательности ДНК зашифрованы все свойства организма; линейная структура конкретного гена однозначно определяет линейную структуру соответствующего ему белка, которая, в свою очередь, однозначно определяет роль этого белка в формировании того или иного признака. Другими словами, «ДНК рождает РНК; РНК рождает белок, а белок рождает нас с вами» (Ф. Крик). Если это верно, то для того, чтобы изменить тот или иной признак (например, вылечить болезнь, имеющую генетические корни), достаточно установить соответствующую ему последовательность участка ДНК и исправить ее. Но так ли все просто? Достаточно ли знаний (хотя они бесспорно верны и необходимы!) о структурных соответствиях на пути от гена к признаку, для того чтобы понять и воспроизвести этот путь?

Последние достижения генетики показали, что недостаточны. В 2003 году в рамках проекта «Геном человека» была полностью определена линейная структура ДНК человека (и многих других простых и сложных организмов). Как сказал один из ученых, «прочитаны все буквы, которыми написана толстая книга, теперь еще понять бы слова и их смысл». Выяснилось, что собственно генов (участков ДНК, кодирующих белки) у человека около 30 000, и это лишь 1–3 % всей ДНК! Столько же генов у растения Arabidopsis taliana и рыбы фугу. Более того, 99 % генов человека совпадают с генами мыши, то есть человек имеет всего 300 генов, которых нет у мыши. (Трудно представить, что у нас и мышей одинаковы еще и 99 % признаков!)

Дальше – больше. Оказалось, что однозначная взаимосвязь между геном и белком существует только у бактерий. А у человека возможно образование многих белков на основании одного гена (максимально известное сегодня число разных белков, кодируемых одним геном, – 40 000!) и возникновение многих функций у одного белка. Получается, что путь от потенциального к проявленному, от генетической информации к признаку отнюдь не линейный; что каждый признак является результатом сложных взаимодействий многих генов и их продуктов-белков; что само понятие «ген» из-за своей неоднозначности вряд ли может служить «отправным пунктом» этого пути.

Взаимодействие структур

Тело человека состоит из 1014 клеток. Все они имеют абсолютно одинаковую ДНК, но существенно различаются по форме, размерам и своим задачам. Разрешение этого парадокса – в избирательном считывании генетической информации. В каждой клетке активными являются только те гены, которые ей в данный момент необходимы. Избирательность обеспечивают специальные гены-регуляторы, которые разрешают или запрещают считывание информации с того или иного участка ДНК. Активность гена зависит и от его окружения в пространстве клеточного ядра. Смена окружения, вызванная перемещением самого гена или кого-то из его соседей, способна изменить его активность («выключить» или «включить» ген). Например, в геноме человека есть масса потенциально опасных вирусных генов и протоонкогенов (способных вызвать раковое перерождение клетки). Они могут долгое время (и всю жизнь) вести себя вполне мирно и даже работать на благо клетки, до тех пор пока перемещение их самих или кого-то из окружения не выявит в этих генах агрессивные потенциалы. К счастью, могут произойти другие перемещения, которые утихомирят «бунтовщика» или включат защитные механизмы.

Итак, носитель генетической информации переместился с уровня гена (конкретного участка ДНК) на эпигенетический (от латинского «над», «сверх») уровень взаимодействия генов между собой и с другими структурами ядра клетки (99 % негенной ДНК и белками). Предположим, наука расшифрует механизм этого взаимодействия. Приведет ли это к раскрытию тайны жизни? Жизнь – это только лишь структура? А если нет, стоит ли в поисках разгадки тайны жизни ограничиваться взаимодействием структур?

Кто сторожит сторожа?

Как из единственной клетки в результате 46 делений получается не бесформенная масса из 1014 клеток, а весьма характерное тело каждого из нас? Последовательно удваиваясь, клетки не только сами становятся разными, но еще и формируют разные части тела в нужное время и в нужном месте. Что управляет организацией клеток во времени и пространстве? Целое, которое качественно больше простой суммы составляющих его частей-клеток. И это не противоречит тому, что организм образуется из одной клетки, – вопрос в том, что для этой клетки воплощает «волю целого». Поиски подобного упорядочивающего фактора вылились в начале XX века в концепцию морфогенетического поля. Ее основоположником стал русский ученый А. Г. Гурвич.

Когда Гурвич работал над теорией поля, молекула ДНК считалась составной частью хромосом, и ей не придавали особого значения. В 1944 году ученый опубликовал свой труд «Теория биологического поля». Этот год стал судьбоносным для всей генетики, определив путь ее развития на несколько десятилетий вперед. В центре внимания ученых оказалась молекула ДНК, поскольку было доказано, что именно ей принадлежит ведущая роль в передаче наследственной информации. Не за горами был и 1953-й… В результате все свое внимание наука сосредоточила на структуре ДНК, которую фактически стала отождествлять с переносимой ею информацией, а теория биологического поля оказалась не в почете. Но исследования в этой области продолжались, и все эти годы два пути познания тайны жизни шли параллельно…

Переход в новое тысячелетие изменил соотношение сил в науках о жизни. Все больше ученых приходят к тому, что структурный ключ в познании живого необходим, но недостаточен; что разные подходы не исключают друг друга, а образуют объединенный путь научного поиска; что по сути своей структурный подход и теория поля комплементарны. Вспомним: именно предположение о комплементарности цепей ДНК стало ключом к расшифровке ее структуры, а само открытие 1953 года оказалось возможным благодаря комплементарности усилий представителей разных областей науки – физиков, химиков, биологов. Может быть, объединенная наука нового тысячелетия не только окончательно примирит разные научные подходы (например, структурный и полевой), но и обратится к плодам «ненаучного» пути познания тайны жизни – тысячелетней мудрости человечества, – «ненаучного», поскольку этот путь уходит корнями в те времена, когда науки не было и в помине. Обращение к источникам древней мудрости способно дать науке ключи от двери, за которой скрыта тайна. Но чтобы это произошло, столь разные пути познания должны где-то «пересечься». Одним из таких «перекрестков» может стать концепция формообразующего поля (биологического, морфогенетического, информационного), выросшая на почве современной науки и восходящая к явлениям, рассматривавшимся в древних источниках. Последние говорят о том, что человек состоит из нескольких тел, или принципов, которые не являются отдельными, независимыми частями, а взаимопроникают и взаимоформируют друг друга; что видимое, плотное, физическое тело является проводником, носителем более тонкоматериальных тел, которые с его помощью проявляются в физическом мире и взаимодействуют с ним; что «сборкой» – формированием физического тела из элементов физической материи – управляет самое «плотное» из этих тел, астральное тело-прообраз (план, матрица).

Современная наука знает, что каждая вновь образовавшаяся клетка участвует в формировании организма согласно индивидуальной «инструкции» (активные, или включенные, гены) и что у родителя и у потомков этой клетки могут быть совсем другие «инструкции». Но что и как согласует переключения индивидуальных «программ» развития миллиардов клеток, пока не ясно. Теория биологического поля предполагает, что согласование есть функция целого, которое и является тем самым полем, матрицей или моделью; что каждая вновь образовавшаяся клетка с помощью собственного генетического аппарата подключается к единому «плану» развития организма, получает оттуда индивидуальные «инструкции» и реализует их в рамках собственной программы поведения. Получается, что генетический аппарат клетки состоит, как минимум, из трех функциональных блоков: воспринимающей «антенны», «пульта управления» активностью генов и «исполнительной» части – генов, ответственных за образование конкретных белков. Вспомним, что на долю генов приходится всего 1–2 % от всей клеточной ДНК. В оставшихся 98–99 % ДНК уже обнаружены структуры, относящиеся ко второму «управляющему блоку». А что играет роль «антенны»? Где происходит «встреча двух миров» – информационного поля и генетических структур, воплощающих эту информацию в конкретное физическое тело?

Мост от потенциального к проявленному

Почему бы не предположить, что роль антенны, способной улавливать, трансформировать и передавать сигналы волновой природы, тоже играет ДНК? К этому располагает и спиральная структура «молекулы жизни» (многие технические антенны имеют форму спирали), и такие ее свойства, как способность проводить электрический ток, возможность резонансного возбуждения продольных колебаний под действием радиоволн, а также способность к лазерной генерации света после предварительной «накачки».

Если ДНК может работать на прием информации, обеспечивающей жизненную активность клеток, то ей вовсе не обязательно постоянно хранить эту информацию в своей структуре. Как, например, мозгу человека, чтобы успешно управлять системами жизнеобеспечения организма, не обязательно быть «вместилищем» разума, а достаточно играть роль посредника между сознанием и телом: он воспринимает информацию из плана сознания и «переводит» ее на язык управления телом.

И ясно, почему в случае повреждений структуры ДНК (или мозговых структур) страдает физическое тело. Ведь всем известно, что при неисправности в телевизоре хотя бы одной детали изображение на его экране сильно искажается, а если телевизор лишить антенны или выключить его из сети, на экране вообще ничего не появится.

ДНК – связующее звено между «моделью» физического тела и ее конкретным воплощением. Мозг – посредник между разумом и телом. Разум связывает жизнь и форму ее проявления и позволяет жизни, заключенной в форме, познавать саму себя. С помощью этого замечательного инструмента человек имеет возможность изучать окружающий мир и находить в нем ключи к познанию своего внутреннего мира. Так рождается объединенный путь, ведущий к познанию тайны жизни. Ибо человек есть величайшая из тайн – тайна взаимосвязи земли и неба.

 

Наталья Аднорал, канд. мед. наук

rutlib4.com

ДНК. Основные понятия.

ДНК ПРОКАРИОТ И ЭУКАРИОТ

jzwvo9_z7ag.jpg Крупнейшая спираль ДНК человека, выстроенная из людей на пляже в Варне (Болгария), вошедшая в книгу рекордов Гиннесса

Справа крупнейшая спираль ДНК человека, выстроенная из людей на пляже в Варне (Болгария), вошедшая в книгу рекордов Гиннесса 23 апреля 2016 года

Дезоксирибонуклеиновая кислота. Общие сведения

DNAСодержание страницы:

ДНК (дезоксирибонуклеиновая кислота) – своеобразный чертеж жизни, сложный код, в котором заключены данные о наследственной информации. Эта сложная макромолекула способна хранить и передавать наследственную генетическую информацию из поколения в поколение. ДНК определяет такие свойства любого живого организма как наследственность и изменчивость. Закодированная в ней информация задает всю программу развития любого живого организма. Генетически заложенные факторы предопределяют весь ход жизни как человека, так и любого др. организхма. Искусственное или естественное воздействие внешней среды способны лишь в незначительной степени повлиять на общую выраженность отдельных генетических признаков или сказаться на развитии запрограммированных процессов.

Дезоксирибонуклеи́новая кислота (ДНК) — макромолекула (одна из трёх основных, две другие — РНК и белки), обеспечивающая хранение, передачу из поколения в поколение и реализацию генетической программы развития и функционирования живых организмов. ДНК содержит информацию о структуре различных видов РНК и белков.

В клетках эукариот (животных, растений и грибов) ДНК находится в ядре клетки в составе хромосом, а также в некоторых клеточных органоидах (митохондриях и пластидах). В клетках прокариотических организмов (бактерий и архей) кольцевая или линейная молекула ДНК, так называемый нуклеоид, прикреплена изнутри к клеточной мембране. У них и у низших эукариот (например, дрожжей) встречаются также небольшие автономные, преимущественно кольцевые молекулы ДНК, называемые плазмидами.

С химической точки зрения ДНК — это длинная полимерная молекула, состоящая из повторяющихся блоков — нуклеотидов. Каждый нуклеотид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы. Связи между нуклеотидами в цепи образуются за счёт дезоксирибозы (С) и фосфатной (Ф) группы (фосфодиэфирные связи).

Каждый нуклеотид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы.

Рис. 2. Нуклертид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы

В подавляющем большинстве случаев (кроме некоторых вирусов, содержащих одноцепочечную ДНК) макромолекула ДНК состоит из двух цепей, ориентированных азотистыми основаниями друг к другу. Эта двухцепочечная молекула закручена по винтовой линии.

В ДНК встречается четыре вида азотистых оснований (аденин, гуанин, тимин и цитозин). Азотистые основания одной из цепей соединены с азотистыми основаниями другой цепи водородными связями согласно принципу комплементарности: аденин соединяется только с тимином (А-Т), гуанин — только с цитозином (Г-Ц). Именно эти пары и составляют «перекладины» винтовой "лестницы" ДНК (см.: рис. 2, 3 и 4).

Аденин - тимин, цитозин - гуанин

Рис. 2. Азотистые основания

Последовательность нуклеотидов позволяет «кодировать» информацию о различных типах РНК, наиболее важными из которых являются информационные, или матричные (мРНК), рибосомальные (рРНК) и транспортные (тРНК). Все эти типы РНК синтезируются на матрице ДНК за счёт копирования последовательности ДНК в последовательность РНК, синтезируемой в процессе транскрипции, и принимают участие в биосинтезе белков (процессе трансляции). Помимо кодирующих последовательностей, ДНК клеток содержит последовательности, выполняющие регуляторные и структурные функции.

репликация

Рис. 3. Репликация ДНК

Расположение базовых комбинаций химических соединений ДНК и количественные соотношения между этими комбинациями обеспечивают кодирование наследственной информации.

Образование новой ДНК (репликация)

  1. Процесс репликации: раскручивание двойной спирали ДНК — синтез комплементарных цепей ДНК-полимеразой — образование двух молекул ДНК из одной.
  2. Двойная спираль «расстегивается» на две ветви, когда ферменты разрушают связь между базовыми парами химических соединений.
  3. Каждая ветвь является элементом новой ДНК. Новые базовые пары соединяются в той же последовательности, что и в родительской ветви.

По завершении дупликации образуются две самостоятельные спирали, созданные из химических соединений родительской ДНК и имеющие с ней одинаковый генетический код. Таким путем ДНК способна перерывать информацию от клетки к клетке.

Более подробная информация:

СТРОЕНИЕ НУКЛЕИНОВЫХ КИСЛОТ

agct

Рис. 4 . Азотистые основания: аденин, гуанин, цитозин, тимин

Дезоксирибонуклеиновая кислота (ДНК) относится к нуклеиновым кислотам. Нуклеиновые кислоты – это класс нерегулярных биополимеров, мономерами которых являются нуклеотиды.

Нуклеотиды состоят из азотистого основания, соединенного с пятиуглеродным углеводом (пентозой) – дезоксирибозой (в случае ДНК) или рибозой (в случае РНК), который соединяется с остатком фосфорной кислоты (h3PO3–).

Азотистые основания бывают двух типов: пиримидиновые основания – урацил (только в РНК), цитозин и тимин, пуриновые основания – аденин и гуанин.

азотистые, пиримидиновые и пуриновые основания

Рис. 5. Типы азотистых оснований: пиримидиновые и пуриновые

Атомы углерода в молекуле пентозы нумеруются числами от 1 до 5. Фосфат соединяется с третьим и пятым атомами углерода. Так нуклеинотиды соединяются в цепь нуклеиновой кислоты. Таким образом, мы можем выделить 3’ и 5’-концы цепи ДНК:

нуклеинотиды соединяются в цепь нуклеиновой кислоты

Рис. 6. Выделение выделить 3’ и 5’-концов цепи ДНК

Две цепи ДНК образуют двойную спираль. Эти цепи в спирали сориентированы в противоположных направлениях. В разных цепях ДНК азотистые основания соединены между собой с помощью водородных связей. Аденин всегда соединяется с тимином, а цитозин – с гуанином. Это называется правилом комплементарности.

Правило комплементарности:

Например, если нам дана цепь ДНК, имеющая последовательность

3’– ATGTCCTAGCTGCTCG – 5’,

то вторая ей цепь будет комплементарна и направлена в противоположном направлении – от 5’-конца к 3’-концу:

5’– TACAGGATCGACGAGC– 3’.

Направленность цепей молекулы ДНК и соединение азотистых оснований с помощью водородных связей

Рис. 7. Направленность цепей молекулы ДНК и соединение азотистых оснований с помощью водородных связей

РЕПЛИКАЦИЯ

Репликация ДНК – это процесс удвоения молекулы ДНК путем матричного синтеза. Репликация происходит по полуконсервативному механизму. Это значит, что двойная спираль ДНК расплетается и на каждой из ее цепей по принципу комплементарности достраивается новая цепь. Дочерняя молекула ДНК, таким образом, содержит в себе одну цепь от материнской молекулы и одну вновь синтезированную. Репликация происходит в направлении от 3’ к 5’ концу материнской цепи.

репликация ДНК

Рис. 8. Репликация (удвоение) молекулы ДНК

ДНК-синтез – это не такой сложный процесс, как может показаться на первый взгляд. Если подумать, то для начала нужно разобраться, что же такое синтез. Это процесс объединения чего-либо в одно целое. Образование новой молекулы ДНК проходит в несколько этапов:

  • ДНК-топоизомераза, располагаясь перед вилкой репликации, разрезает ДНК для того, чтобы облегчить ее расплетание и раскручивание.
  • ДНК-хеликаза вслед за топоизомеразой влияет на процесс «расплетения» спирали ДНК.
  • Связывающие ДНК-белки осуществляют связывание нитей ДНК, а также проводят их стабилизацию, не допуская их прилипания друг к другу.
  • ДНК-полимераза синтезирует ведущую цепь дочерней ДНК.

репликация ДНК

Рис. 9. Схематическое изображение процесса репликации, цифрами отмечены: (1) Запаздывающая нить, (2) Лидирующая нить, (3) ДНК-полимераза (Polα), (4) ДНК-лигаза, (5) РНК-праймер, (6) Праймаза, (7) Фрагмент Оказаки, (8) ДНК-полимераза (Polδ), (9) Хеликаза, (10) Белки, связывающие одноцепочечную ДНК, (11) Топоизомераза

Строение РНК

Рибонуклеиновая кислота (РНК) — одна из трёх основных макромолекул (две другие — ДНК и белки), которые содержатся в клетках всех живых организмов.

Так же, как ДНК, РНК состоит из длинной цепи, в которой каждое звено называется нуклеотидом. Каждый нуклеотид состоит из азотистого основания, сахара рибозы и фосфатной группы. Однако в отличие от ДНК, РНК обычно имеет не две цепи, а одну. Пентоза в РНК представлена рибозой, а не дезоксирибозой (у рибозы присутствует дополнительная гидроксильная группа на втором атоме углевода). Наконец, ДНК отличается от РНК по составу азотистых оснований: вместо тимина (Т) в РНК представлен урацил (U), который также комплементарен аденину.

Последовательность нуклеотидов позволяет РНК кодировать генетическую информацию. Все клеточные организмы используют РНК (мРНК) для программирования синтеза белков.

Клеточные РНК образуются в ходе процесса, называемого транскрипцией, то есть синтеза РНК на матрице ДНК, осуществляемого специальными ферментами — РНК-полимеразами.

Затем матричные РНК (мРНК) принимают участие в процессе, называемом трансляцией, т.е. синтеза белка на матрице мРНК при участии рибосом. Другие РНК после транскрипции подвергаются химическим модификациям, и после образования вторичной и третичной структур выполняют функции, зависящие от типа РНК.

строение РНК

Рис. 10.  Отличие ДНК от РНК по азотистому основанию: вместо тимина (Т) в РНК представлен урацил (U), который также комплементарен аденину.

ТРАНСКРИПЦИЯ

Транскрипция – это процесс синтеза РНК на матрице ДНК. ДНК раскручивается на одном из участков. На одной из цепей содержится информация, которую необходимо скопировать на молекулу РНК – эта цепь называется кодирующей. Вторая цепь ДНК, комплементарная кодирующей, называется матричной. В процессе транскрипции на матричной цепи в направлении 3’ – 5’ (по цепи ДНК) синтезируется комплементарная ей цепь РНК. Таким образом, создается РНК-копия кодирующей цепи.

Транскрипция

Рис. 11. Схематическое изображение транскрипции

Например, если нам дана последовательность кодирующей цепи

3’– ATGTCCTAGCTGCTCG – 5’,

то, по правилу комплементарности, матричная цепь будет нести последовательность

5’– TACAGGATCGACGAGC– 3’,

а синтезируемая с нее РНК – последовательность

3’– AUGUCCUAGCUGCUCG – 5’.

ТРАНСЛЯЦИЯ

Рассмотрим механизм синтеза белка на матрице РНК, а также генетический код и его свойства. Также для наглядности по ниже приведенной ссылке рекомендуем посмотреть небольшое видео о процессах транскрипции и трансляции, происходящих в живой клетке:

video.jpg В представленном видоролике (кнопка-ссылка слева) показан процесс образования белка из аминокислот. Наглядно (в анимированном варианте) продемонстрированы процессы транскрипции и трансляции. Биосинтез белка на рибосоме также кратко описан в разделе Аминокислоты белков. Более подробное видео о геноме, ДНК и ее структуре, а также процессах кодировки представленно ниже на данной странице: Видео по теме ДНК
СИНТЕЗ БЕЛКА

Рис. 12. Процесс синтеза белка: ДНК кодирует РНК, РНК кодирует белок

ГЕНЕТИЧЕСКИЙ КОД

Генетический код - способ кодирования аминокислотной последовательности белков с помощью последовательности нуклеотидов. Каждая аминокислота кодируется последовательностью из трех нуклеотидов - кодоном или триплетом.

Генетический код, общий для большинства про- и эукариот. В таблице приведены все 64 кодона и указаны соответствующие аминокислоты. Порядок оснований — от 5' к 3' концу мРНК.

Таблица 1. Стандартный генетический код

Среди триплетов есть 4 специальных последовательности, выполняющих функции «знаков препинания»:

  • *Триплет AUG, также кодирующий метионин, называется старт-кодоном. С этого кодона начинается синтез молекулы белка. Таким образом, во время синтеза белка, первой аминокислотой в последовательности всегда будет метионин.
  • **Триплеты UAA, UAG и UGA называются стоп-кодонами и не кодируют ни одной аминокислоты. На этих последовательностях синтез белка прекращается.

Свойства генетического кода

1. Триплетность. Каждая аминокислота кодируется последовательностью из трех нуклеотидов – триплетом или кодоном.

Непрерывность. Между триплетами нет никаких дополнительных нуклеотидов, информация считывается непрерывно.

2. Непрерывность. Между триплетами нет никаких дополнительных нуклеотидов, информация считывается непрерывно.

Непрерывность. Между триплетами нет никаких дополнительных нуклеотидов, информация считывается непрерывно.

3. Неперекрываемость. Один нуклеотид не может входить одновременно в два триплета.

Неперекрываемость. Один нуклеотид не может входить одновременно в два триплета.

4. Однозначность. Один кодон может кодировать только одну аминокислоту.

Однозначность. Один кодон может кодировать только одну аминокислоту.

5. Вырожденность. Одна аминокислота может кодироваться несколькими разными кодонами.

Вырожденность. Одна аминокислота может кодироваться несколькими разными кодонами.

6. Универсальность. Генетический код одинаков для всех живых организмов.

Пример. Нам дана последовательность кодирующей цепи:

3’– CCGATTGCACGTCGATCGTATA– 5’.

Матричная цепь будет иметь последовательность:

5’– GGCTAACGTGCAGCTAGCATAT– 3’.

Теперь «синтезируем» с этой цепи информационную РНК:

3’– CCGAUUGCACGUCGAUCGUAUA– 5’.

Синтез белка идет в направлении 5’ → 3’, следовательно, нам нужно перевернуть последовательность, чтобы «прочитать» генетический код:

5’– AUAUGCUAGCUGCACGUUAGCC– 3’.

Теперь найдем старт-кодон AUG:

5’– AUAUGCUAGCUGCACGUUAGCC– 3’.

Разделим последовательность на триплеты:

деление последовательности на триплеты

Найдем стоп-кодон и согласно таблице генетического кода запишем последовательность аминокислот:

Найдем стоп-кодон и согласно таблице генетического кода запишем последовательность аминокислот

Центральная догма молекулярной биологии звучит следующим образом: информация с ДНК передается на РНК (транскрипция), с РНК – на белок (трансляция). ДНК также может удваиваться путем репликации, и также возможен процесс обратной транскрипции, когда по матрице РНК синтезируется ДНК, но такой процесс в основном характерен для вирусов.

Центральная догма молекулярной биологии

Рис. 13. Центральная догма молекулярной биологии

ГЕНОМ: ГЕНЫ и ХРОМОСОМЫ

(общие понятия)

Геном - совокупность всех генов организма; его полный хромосомный набор.

Термин "геном" был предложен Г. Винклером в 1920 г. для описания совокупности генов, заключенных в гаплоидном наборе хромосом организмов одного биологического вида. Первоначальный смысл этого термина указывал на то, что понятие генома в отличие от генотипа является генетической характеристикой вида в целом, а не отдельной особи. С развитием молекулярной генетики значение данного термина изменилось. Известно, что ДНК, которая является носителем генетической информации у большинства организмов и, следовательно, составляет основу генома, включает в себя не только гены в современном смысле этого слова. Большая часть ДНК эукариотических клеток представлена некодирующими ("избыточными") последовательностями нуклеотидов, которые не заключают в себе информации о белках и нуклеиновых кислотах. Таким образом, основную часть генома любого организма составляет вся ДНК его гаплоидного набора хромосом.

Гены — это участки молекул ДНК, кодирующие полипептиды и молекулы РНК

За последнее столетие наше представление о генах существенно изменилось. Ранее геном называли участок хромосомы, кодирующий или определяющий один признак или фенотипическое (видимое) свойство, например цвет глаз.

Безымянный3

Рис. 14. Соответствие между кодирующими участками ДНК, мРНК и аминокислотной последовательностью полипептидной цепи. 

В 1940 г. Джордж Бидл и Эдвард Тейтем предложили молекулярное определение гена. Ученые обрабатывали споры гриба Neurospora crassa рентгеновским излучением и другими агентами, вызывающими изменения в последовательности ДНК (мутации), и обнаружили мутантные штаммы гриба, утратившие некоторые специфические ферменты, что в некоторых случаях приводило к нарушению целого метаболического пути. Бидл и Тейтем пришли к выводу, что ген — это участок генетического материала, который определяет или кодирует один фермент. Так появилась гипотеза «один ген — один фермент». Позднее эта концепция была расширена до определения «один ген — один полипептид», поскольку многие гены кодируют белки, не являющиеся ферментами, а полипептид может оказаться субъединицей сложного белкового комплекса.

На рис. 14 показана схема того, как триплеты нуклеотидов в ДНК определяют полипептид -  аминокислотную последовательность белка при посредничестве мРНК. Одна из цепей ДНК играет роль матрицы для синтеза мРНК, нуклеотидные триплеты (кодоны) которой комплементарны триплетам ДНК. У некоторых бактерий и многих эукариот кодирующие последовательности прерываются некодирующими участками(так называемыми интронами).

Современное биохимическое определение гена еще более конкретно. Генами называются все участки ДНК, кодирующие первичную последовательность конечных продуктов, к которым относятся полипептиды или РНК, обладающие структурной или каталитической функцией.

Наряду с генами ДНК содержит и другие последовательности, выполняющие исключительно регуляторную функцию. Регуляторные последовательности могут обозначать начало или конец генов, влиять на транскрипцию или указывать место инициации репликации или рекомбинации. Некоторые гены могут экспрессироваться разными путями, при этом один и тот же участок ДНК служит матрицей для образования разных продуктов.

Мы можем приблизительно рассчитать минимальный размер гена, кодирующего средний белок. Каждая аминокислота в полипептидной цепи кодируется последовательностью из трех нуклеотидов; последовательности этих триплетов (кодонов) соответствуют цепочке аминокислот в полипептиде, который кодируется данным геном. Полипептидная цепь из 350  аминокислотных остатков (цепь средней длины) соответствует последовательности из 1050 п.н. (пар нуклеотидов). Однако многие гены эукариот и некоторые гены прокариот прерываются сегментами ДНК, не несущими информации о белке, и поэтому оказываются значительно длиннее, чем показывает простой расчет.

Сколько генов в одной хромосоме?

Хромосомы прокариот и эукариотРис. 15. Вид хромосом в прокаритической (слева) и эукариотической клеках. Гистоны (Histones) — обширный класс ядерных белков, выполняющих две основные функции: они участвуют в упаковке нитей ДНК в ядре и в эпигенетической регуляции таких ядерных процессов, как транскрипция, репликация и репарация.

Как известно, бактериальные клетки имеют хромосому в виде нити ДНК, уложенной в компактную структуру – нуклеоид. Хромосома прокариота Escherichia coli, чей геном полностью расшифрован, представляет собой кольцевую молекулу ДНК (на самом деле, это не правильный круг, а скорее петля без начала и конца), состоящую из 4 639 675 п.н. В этой последовательности содержится примерно 4300 генов белков и еще 157 генов стабильных молекул РНК. В геноме человека примерно 3,1 млрд пар нуклеотидов, соответствующих почти 29 000 генам, расположенным на 24 разных хромосомах.

Прокариоты (Бактерии).

ДНК из лизированной клетки E. coliБактерия E. coli имеет одну двухцепочечную кольцевую молекулу ДНК. Она состоит из 4 639 675 п.н. и достигает в длину примерно 1,7 мм, что превышает длину самой клетки E. coli приблизительно в 850 раз. Помимо крупной кольцевой хромосомы в составе нуклеоида многие бактерии содержат одну или несколько маленьких кольцевых молекул ДНК, свободно располагающихся в цитозоле. Такие внехромосомные элементы называют плазмидами (рис. 16).

Большинство плазмид состоит всего из нескольких тысяч пар нуклеотидов, некоторые содержат более 10000 п. н. Они несут генетическую информацию и реплицируются с образованием дочерних плазмид, которые попадают в дочерние клетки в процессе деления родительской клетки. Плазмиды обнаружены не только в бактериях, но также в дрожжах и других грибах. Во многих случаях плазмиды не дают никаких преимуществ клеткам-хозяевам, и их единственная задача — независимое воспроизведение. Однако некоторые плазмиды несут полезные для хозяина гены. Например, содержащиеся в плазмидах гены могут придавать клеткам бактерий устойчивость к антибактериальным агентам. Плазмиды, несущие ген β-лактамазы, обеспечивают устойчивость к β-лактамным антибиотикам, таким как пенициллин и амоксициллин. Плазмиды могут переходить от клеток, устойчивых к антибиотикам, к другим клеткам того же или другого вида бактерий, в результате чего эти клетки также становятся резистентными. Интенсивное применение антибиотиков является мощным селективным фактором, способствующим распространению плазмид, кодирующих устойчивость к антибиотикам (а также транспозонов, которые кодируют аналогичные гены) среди болезнетворных бактерий, и приводит к появлению бактериальных штаммов с устойчивостью к нескольким антибиотикам. Врачи начинают понимать опасность широкого использования антибиотиков и назначают их только в случае острой необходимости. По аналогичным причинам ограничивается широкое использование антибиотиков для лечения сельскохозяйственных животных.

См. также: Равин Н.В., Шестаков С.В. Геном прокариот // Вавиловский журнал генетики и селекции, 2013. Т. 17. № 4/2. С. 972–984.

Эукариоты.

Таблица 2. ДНК, гены и хромосомы некоторых организмов

Общая ДНК,

п.н.

Число хромосом*

Примерное число генов

Escherichia coli (бактерия)

4 639 675

1

4 435

Saccharomyces cerevisiae (дрожжи)

12 080 000

16**

5 860

Caenorhabditis elegans (нематода)

90 269 800

12***

23 000

Arabidopsis thaliana (растение)

119 186 200

10

33 000

Drosophila melanogaster (плодовая мушка)

120 367 260

18

20 000

Oryza sativa (рис)

480 000 000

24

57 000

Mus musculus (мышь)

2 634 266 500

40

27 000

Homo sapiens (человек)

3 070 128 600

46

29 000

Примечание. Информация постоянно обновляется; для получения более свежей информации обратитесь к сайтам, посвященным отдельным геномным проектам

*Для всех эукариот, кроме дрожжей, приводится диплоидный набор хромосом. Диплоидный набор хромосом (от греч. diploos- двойной и eidos- вид) – двойной набор хромосом (2n), каждая из которых имеет себе гомологичную.**Гаплоидный набор. Дикие штаммы дрожжей обычно имеют восемь (октаплоидный) или больше наборов таких хромосом.***Для самок с двумя Х хромосомами. У самцов есть Х хромосома, но нет Y, т. е. всего 11 хромосом.

В клетке дрожжей, одних из самых маленьких эукариот, в 2,6 раза больше ДНК, чем в клетке E. coli (табл. 2). Клетки плодовой мушки Drosophila, классического объекта генетических исследований, содержат в 35 раз больше ДНК, а клетки человека — примерно в 700 раз больше ДНК, чем клетки E. coli. Многие растения и амфибии содержат еще больше ДНК. Генетический материал клеток эукариот организован в виде хромосом. Диплоидный набор хромосом (2n) зависит от вида организма (табл. 2).

Например, в соматической клетке человека 46 хромосом (рис. 17). Каждая хромосома эукариотической клетки, как показано на рис. 17, а, содержит одну очень крупную двухспиральную молекулу ДНК. Двадцать четыре хромосомы человека (22 парные хромосомы и две половые хромосомы X и Y)  различаются по длине более чем в 25 раз. Каждая хромосома эукариот содержит определенный набор генов.

хромосомы человека

Рис. 17. Хромосомы эукариот. а — пара связанных и конденсированных сестринских хроматид из хромосомы человека. В такой форме эукариотические хромосомы пребывают после репликации и в метафазе в процессе митоза. б — полный набор хромосом из лейкоцита одного из авторов книги. В каждой нормальной соматической клетке человека содержится 46 хромосом.

Если соединить между собой молекулы ДНК человеческого генома (22 хромосомы и хромосомы X и Y или Х и Х), получится последовательность длиной около одного метра. Прим.: У всех млекопитающих и других организмов с гетерогаметным мужским полом, у самок две X-хромосомы (XX), а у самцов — одна X-хромосома и одна Y-хромосома (XY).

Большинство клеток человека диплоидны, поэтому общая длина ДНК таких клеток около 2м. У взрослого человека примерно 1014 клеток, таким образом, общая длина всех молекул ДНК составляет 2・1011 км. Для сравнения, окружность Земли — 4・104 км, а расстояние от Земли до Солнца — 1,5・108 км. Вот как удивительно компактно упакована ДНК в наших клетках!

В клетках эукариот есть и другие органеллы, содержащие ДНК, — это митохондрии и хлоропласты. Выдвигалось множество гипотез относительно происхождения ДНК митохондрий и хлоропластов. Общепризнанная сегодня точка зрения заключается в том, что они представляют собой рудименты хромосом древних бактерий, которые проникли в цитоплазму хозяйских клеток и стали предшественниками этих органелл. Митохондриальная ДНК кодирует митохондриальные тРНК и рРНК, а также несколько митохондриальных белков. Более 95% митохондриальных белков кодируется ядерной ДНК.

СТРОЕНИЕ ГЕНОВ

Рассмотрим строение гена у прокариот и эукариот, их сходства и различия. Несмотря на то, что ген — это участок ДНК, кодирующий всего один белок или РНК, кроме непосредственно кодирующей части, он также включает в себя регуляторные и иные структурные элементы, имеющие разное строение у прокариот и эукариот.

Кодирующая последовательность – основная структурно-функциональная единица гена, именно в ней находятся триплеты нуклеотидов, кодирующие аминокислотную последовательность. Она начинается со старт-кодона и заканчивается стоп-кодоном.

До и после кодирующей последовательности находятся нетранслируемые 5’- и 3’-последовательности. Они выполняют регуляторные и вспомогательные функции, например, обеспечивают посадку рибосомы на и-РНК.

Нетранслируемые и кодирующая последовательности составлют единицу транскрипции – транскрибируемый участок ДНК, то есть участок ДНК, с которого происходит синтез и-РНК.

Терминатор – нетранскрибируемый участок ДНК в конце гена, на котором останавливается синтез РНК.

В начале гена находится регуляторная область, включающая в себя промотор и оператор.

Промотор – последовательность, с которой связывается полимераза в процессе инициации транскрипции. Оператор – это область, с которой могут связываться специальные белки – репрессоры, которые могут уменьшать активность синтеза РНК с этого гена – иначе говоря, уменьшать его экспрессию.

Строение генов у прокариот

Общий план строения генов у прокариот и эукариот не отличается – и те, и другие содержат регуляторную область с промотором и оператором, единицу транскрипции с кодирующей и нетранслируемыми последовательностями и терминатор. Однако организация генов у прокариот и эукариот отличается.

ген прокариот

Рис. 18. Схема строения гена у прокариот (бактерий) - изображение увеличивается

В начале и в конце оперона есть единые регуляторные области для нескольких структурных генов. С транскрибируемого участка оперона считывается одна молекула и-РНК, которая содержит несколько кодирующих последовательностей, в каждой из которых есть свой старт- и стоп-кодон. С каждого из таких участков синтезируется один белок. Таким образом, с одной молекулы и-РНК синтезируется несколько молекул белка.

Для прокариот характерно объединение нескольких генов в единую функциональную единицу – оперон. Работу оперона могут регулировать другие гены, которые могут быть заметно удалены от самого оперона – регуляторы. Белок, транслируемый с этого гена называется репрессор. Он связывается с оператором оперона, регулируя экспрессию сразу всех генов, в нем содержащихся.

Для прокариот также характерно явление сопряжения транскрипции и трансляции.

явление сопряжения транскрипции и трансляции у прокариот

Рис. 19 Явление сопряжения транскрипции и трансляции у прокариот - изображение увеличивается

Такое сопряжение не встречается у эукариот из-за наличия у них ядерной оболочки, отделяющей цитоплазму, где происходит трансляция, от генетического материала, на котором происходит транскрипция. У прокариот во время синтеза РНК на матрице ДНК с синтезируемой молекулой РНК может сразу связываться рибосома. Таким образом, трансляция начинается еще до завершения транскрипции. Более того, с одной молекулой РНК может одновременно связываться несколько рибосом, синтезируя сразу несколько молекул одного белка.

Строение генов у эукариот

Гены и хромосомы эукариот очень сложно организованы

У бактерий многих видов всего одна хромосома, и почти во всех случаях в каждой хромосоме присутствует по одной копии каждого гена. Лишь  немногие гены, например гены рРНК, содержатся в нескольких копиях. Гены и регуляторные последовательности составляют практически весь геном прокариот. Более того, почти каждый ген строго соответствует аминокислотной последовательности (или последовательности РНК), которую он кодирует (рис. 14).

Структурная и функциональная организация генов эукариот гораздо сложнее. Исследование хромосом эукариот, а позднее секвенирование полных последовательностей геномов эукариот принесло много сюрпризов. Многие, если не большинство, генов эукариот обладают интересной особенностью: их нуклеотидные последовательности содержат один или несколько участков ДНК, в которых не кодируется аминокислотная последовательность полипептидного продукта. Такие нетранслируемые вставки нарушают прямое соответствие между нуклеотидной последовательностью гена и аминокислотной последовательностью кодируемого полипептида. Эти нетранслируемые сегменты в составе генов называют интронами, или встроенными последовательностями, а кодирующие сегменты — экзонами. У прокариот лишь немногие гены содержат интроны.

Итак, у эукариот практически не встречается объединение генов в опероны, и кодирующая последовательность гена эукариот чаще всего разделена на транслируемые участки – экзоны, и нетранслируемые участки – интроны.

В большинстве случаев функция интронов не установлена. В целом, лишь около 1,5% ДНК человека являются ≪кодирующими≫, т. е. несут информацию о белках или РНК. Однако с учетом крупных интронов получается, что ДНК человека на 30% состоит из генов. Поскольку гены составляют относительно небольшую долю в геноме человека, значительная часть ДНК остается неучтенной.

Схема строение гена у эукариот

Рис. 16. Схема строение гена у эукариот - изображение увеличивается

С каждого гена сначала синтезируется незрелая, или пре-РНК, которая содержит в себе как интроны, так и экзоны.

После этого проходит процесс сплайсинга, в результате которого интронные участки вырезаются, и образуется зрелая иРНК, с которой может быть синтезирован белок.

процесс альтернативного сплайсинга

Рис. 20. Процесс альтернативного сплайсинга - изображение увеличивается

Такая организация генов позволяет, например, осуществить процесс альтернативного сплайсинга, когда с одного гена могут быть синтезированы разные формы белка, за счет того, что в процессе сплайсинга экзоны могут сшиваться в разных последовательностях.

Сравнение строения генов прокариот и эукариот

Сравнение строения генов прокариот и эукариот

Рис. 21. Отличия в строении генов прокариот и эукариот - изображение увеличивается

МУТАЦИИ И МУТАГЕНЕЗ

Мутацией называется стойкое изменение генотипа, то есть изменение нуклеотидной последовательности.

Процесс, который приводит к возникновению мутаций называется мутагенезом, а организм, все клетки которого несут одну и ту же мутацию — мутантом.

Мутационная теория была впервые сформулирована Гуго де Фризом в 1903 году. Современный ее вариант включает в себя следующие положения:

1. Мутации возникают внезапно, скачкообразно.

2. Мутации передаются из поколения в поколение.

3. Мутации могут быть полезными, вредными или нейтральными, доминантными или рецессивными.

4. Вероятность обнаружения мутаций зависит от числа исследованных особей.

5. Сходные мутации могут возникать повторно.

6. Мутации не направленны.

Мутации могут возникать под действием различных факторов. Различают мутации, возникшие под действием мутагенных воздействий: физических (например, ультрафиолета или радиации), химических (например, колхицина или активных форм кислорода) и биологических (например, вирусов). Также мутации могут быть вызваны ошибками репликации.

В зависимости от условий появления мутации подразделяют на спонтанные — то есть мутации, возникшие в нормальных условиях, и индуцированые — то есть мутации, которые возникли при особых условиях.

Мутации могут возникать не только в ядерной ДНК, но и, например, в ДНК митохондрий или пластид. Соответственно, мы можем выделять ядерные и цитоплазматические мутации.

В результате возникновения мутаций часто могут появляться новые аллели. Если мутантный аллель подавляет действие нормального, мутация называется доминантной. Если нормальный аллель подавляет мутантный, такая мутация называется рецессивной. Большинство мутаций, приводящих к возникновению новых аллелей являются рецессивными.

По эффекту выделяют мутации адаптивные, приводящие к повышению приспособленности организма к среде, нейтральные, не влияющие на выживаемость, вредные, понижающие приспособленность организмов к условиям среды и летальные, приводящие к смерти организма на ранних стадиях развития.

По последствиям выделяются мутации, приводящие к потери функции белка, мутации, приводящие к возникновению у белка новой функции, а также мутации, которые изменяют дозу гена, и, соответственно, дозу белка синтезируемого с него.

Мутация может возникнуть к любой клетке организма. Если мутация возникает в половой клетке, она называется герминативной (герминальной, или генеративной). Такие мутации не проявляются у того организма, у которого они появились, но приводят к появлению мутантов в потомстве и передаются по наследству, поэтому они важны для генетики и эволюции. Если мутация возникает в любой другой клетке, она называется соматической. Такая мутация может в той или иной степени проявляться у того организма, у которого она возникла, например, приводить к образованию раковых опухолей. Однако такая мутация не передается по наследству и не влияет на потомков.

Мутации могут затрагивать разные по размеру участки генома. Выделяют генные, хромосомные и геномные мутации.

Генные мутации

Мутации, которые возникают в масштабе меньшем, чем один ген, называются генными, или точечными (точковыми). Такие мутации приводят к изменению одного и нескольких нуклеотидов в последовательности. Среди генных мутаций выделяют замены, приводящие к замене одного нуклеотида на другой, делеции, приводящие к выпадению одного из нуклеотидов, инсерции, приводящие к добавлению лишнего нуклеотида в последовательность.

Генные мутации: замены, делеции, инсерции

Рис. 23. Генные (точечные) мутации

По механизму воздействия на белок, генные мутации делят на: синонимичные, которые (в результате вырожденности генетического кода) не приводят к изменению аминокислотного состава белкового продукта, миссенс-мутации, которые приводят к замене одной аминокислоты на другую и могут влиять на структуру синтезируемого белка, хотя часто они оказываются незначительными, нонсенс-мутации, приводящие к замене кодирующего кодона на стоп-кодон, мутации, приводящие к нарушению сплайсинга:

синонимичные, миссенс-мутации и нонсенс-мутации

Рис. 24. Схемы мутаций

Также по механизму воздействия на белок выделяют мутации, приводящие к сдвигу рамки считывания, например, инсерции и делеции. Такие мутации, как и нонсенс-мутации, хоть и возникают в одной точке гена, часто воздействуют на всю структуру белка, что может привести к полному изменению его структуры.мутации сдвига рамки считывания

Рис. 25. Схема мутации, приводящей к сдвигу рамки считывания

Хромосомные мутации

khromosomnyye_aberratsii

Рис. 26. Хромосомные абберации

Хромосомными мутациями называются мутации, которые затрагивают отдельные гены в рамках одной хромосомы. Различают делеции, когда теряется один или несколько генов, дупликации, когда удваивается тот или иной ген или несколько генов, инверсии, когда участок хромосомы поворачивается на 180 градусов, транслокации, когда гены переходят с одной хромосомы на другую. 

Хромосомные мутации - делеции, дупликации, инверсии.  

Рис. 27. Схемы хромосомных мутаций: делеции, дупликации, инверсии

транслокация - гены переходят с одной хромосомы на другую дупликация

Рис. 28. Транслокация

Рис. 29. Хромосома до и после дупликации

Геномные мутации

Наконец, геномные мутации затрагивают весь геном целиком, то есть меняется количество хромосом. Выделяют полиплоидии — увеличение плоидности клетки, и анеуплоидии, то есть изменение количества хромосом, например, трисомии (наличие у одной из хромосом дополнительного гомолога) и моносомии (отсутствие у хромосомы гомолога).

Видео по теме ДНК

СИНТЕЗ БЕЛКА ИЗ АМИНОКИСЛОТ ИЛИ ПОСТУЛАТ МОЛЕКУЛЯРНОЙ БИОЛОГИИ: ДНК КОДИРУЕТ РНК, РНК КОДИРУЕТ БЕЛОК

К разделу АНТИМУТАГЕННЫЕ СВОЙСТВА

Будьте здоровы!

 

ССЫЛКИ К РАЗДЕЛУ О ПРЕПАРАТАХ ПРОБИОТИКАХ

  1. ПРОБИОТИКИ
  2. ДОМАШНИЕ ЗАКВАСКИ
  3. БИФИКАРДИО
  4. КОНЦЕНТРАТ БИФИДОБАКТЕРИЙ ЖИДКИЙ
  5. ПРОПИОНИКС
  6. ЙОДПРОПИОНИКС
  7. СЕЛЕНПРОПИОНИКС
  8. БИФИДОБАКТЕРИИ
  9. ПРОПИОНОВОКИСЛЫЕ БАКТЕРИИ
  10. ПРОБИОТИКИ И ПРЕБИОТИКИ
  11. СИНБИОТИКИ
  12. АНТИОКСИДАНТНЫЕ СВОЙСТВА
  13. АНТИОКСИДАНТНЫЕ ФЕРМЕНТЫ
  14. АНТИМУТАГЕННАЯ АКТИВНОСТЬ
  15. МИКРОФЛОРА КИШЕЧНОГО ТРАКТА
  16. МИКРОФЛОРА И ФУНКЦИИ МОЗГА
  17. ПРОБИОТИКИ И ХОЛЕСТЕРИН
  18. ПРОБИОТИКИ ПРОТИВ ОЖИРЕНИЯ
  19. МИКРОФЛОРА И САХАРНЫЙ ДИАБЕТ
  20. ПРОБИОТИКИ и ИММУНИТЕТ
  21. ПРОБИОТИКИ и ГРУДНЫЕ ДЕТИ
  22. ДИСБАКТЕРИОЗ
  23. МИКРОЭЛЕМЕНТНЫЙ СОСТАВ
  24. ПРОБИОТИКИ С ПНЖК
  25. ВИТАМИННЫЙ СИНТЕЗ
  26. АМИНОКИСЛОТНЫЙ СИНТЕЗ
  27. АНТИМИКРОБНЫЕ СВОЙСТВА
  28. СИНТЕЗ ЛЕТУЧИХ ЖИРНЫХ КИСЛОТ
  29. СИНТЕЗ БАКТЕРИОЦИНОВ
  30. ФУНКЦИОНАЛЬНОЕ ПИТАНИЕ
  31. АЛИМЕНТАРНЫЕ ЗАБОЛЕВАНИЯ
  32. ПРОБИОТИКИ ДЛЯ СПОРТСМЕНОВ
  33. ПРОИЗВОДСТВО ПРОБИОТИКОВ
  34. ЗАКВАСКИ ДЛЯ ПИЩЕВОЙ ПРОМЫШЛЕННОСТИ
  35. НОВОСТИ

propionix.ru

САКРАЛЬНАЯ ГЕОМЕТРИЯ ДНК - АсСалам

Со времен школы мы имеем представление о ДНК как о подобии веревочной лестницы, закрученной по странноватого вида спирали (если кто помнит, конечно). Это правда, чистая правда... только не вся правда.

С точки зрения сакральной геометрии, реальность, стоящая за структурой ДНК, намного интереснее.

Это додекаэдр  – одно из платоновых тел, состоящее из двенадцати пятиугольных граней. В школе Пифагора додекаэдр полагался настолько священным, что даже название его было запрещено произносить за стенами школы, под страхом смерти. Он считался базовой формой Вселенной... и, как выясняется в настоящее время, далеко не без оснований. Впервые о додекаэдре открыто заговорил Платон, хотя и тот тоже не очень распространялся об этой структуре. Тем не менее, название «платоновы тела» правильным многогранникам дали именно с времен школы Платона.

Если бы мы начали вращать наш столь священный двенадцатигранник по спирали с определенным приращением угла поворота, то оставленный им след был бы идентичен двойной спирали ДНК. Можно сказать, что форма ДНК – это трехмерный след, оставленный вращением додекаэдра в четвертом измерении. Что же это за особое приращение угла поворота, дающее след, похожий на ДНК? По вертикали оно должно быть равно пропорции Золотого Сечения, по горизонтали – ее квадрату.

На нижеприведенной иллюстрации Дэна Винтера это хорошо видно: слева десять положений вращающегося додекаэдра обозначены разными цветами, а справа разными цветами обозначены получающиеся двойные спирали ДНК-подобной структуры.

Источник иллюстрации, озаглавленной «Двойная спираль ДНК – след, оставленный додекаэдром», а также всех последующих в этой заметке иллюстраций

  В этом месте хочется спросить: а почему, собственно, додекаэдр? Что в нем такого важного и уникального, что вся земная генетика сошлась на нем клином?

Додекаэдр избран биологическими объектами для их ДНК по той причине, что геометрия пятиугольников – его двенадцати граней – основана на пропорции Золотого Сечения, которую все живое во Вселенной выбирает в качестве «единого языка» и «космического ГОСТа»

Вид ДНК сверху, смоделированный Дэном на компьютере, выглядит примерно так:

Из модели хорошо видно, что ДНК состоит из целого каскада пентаграмм, через которые, как оказывается, можно провести десять спиралей Золотого Сечения. Эти фрактальные спирали, как подробнее объяснялось ранее, являются разметкой вихреобразного гравитационного поля, с помощью которого ДНК притягивает и отдает клеткам электромагнитный заряд или, говоря попросту, жизненную силу.  Мы уже обсуждали идею о том, что гравитационное притяжение – одна из форм любви, поэтому можно сказать, что наша ДНК была задумана не просто как генетический материал, а еще и как антенна, предназначенная притягивать в клетки жизненный заряд при помощи силы любви.

Неплохо придумано, да?

Гравитационное поле ДНК: вид сверху, в разрезе и сбоку

Дэн Винтер был далеко не первым из исследователей, выдвинувших идею о том, что ДНК - фрактальная антенна, созданная как проводник для электромагнитного заряда. Есть, например, вот такой источник, в котором его авторы, американские ученые из Колумбийского Университета, утверждают: «ДНК проявляет два свойства фрактальной антенны – самоподобие и электропроводность».

К этому Дэн добавил бы только: «...свойства золотосеченной фрактальной антенны».

Поскольку он считает, что Вселенная – фрактал, и все в ней связано со всем посредством волн, резонирующих по Золотому сечению, он предполагает, что ДНК связана как с электромагнитным полем Земли, так и с окружающим планету космическим пространством, представленным двенадцатигранником, условно называемым Зодиаком.

Дэн показывает этот принцип схематически в виде ряда пентаграмм – самая большая представляет Зодиак, чуть меньше – магнитное поле Земли, и далее, в самом основании – ДНК.

Космические факторы оказывают влияние на клетки нашего тела, беспрепятственно сходя вниз по «золоченой лестнице» в самое сердце ДНК... и все благодаря простой вещи – самоподобию частей целому. Истинно говорится в «Вишвасара-тантре»: «То, что есть здесь, есть повсюду. Чего нет здесь, нет нигде».

Принцип Omnia in Unum («В многообразии – единство») объясняет то значение, которое придавалось в традиционной медицине астрологическим влияниям. Парацельс, например, назначал курс лечения и лекарства строго в соответствии с зодиакальными факторами, а этот человек уж точно был не профан.

Конечно, ряд фрактальных пятиугольников на схеме - лишь упрощение, примененное с целью наглядности. На самом деле и поле Земли, и более масштабные структуры вокруг Солнечной системы в 3D представляют из себя додекаэдры или сочетания додекаэдра и икосаэдра (оба эти платонова тела, как мы помним – золотосеченные фракталы).  Приведенная ниже иллюстрация – обложка американского научного журнала «Нэйчер» (Nature), где была помещена статья с гипотезой о том, что Вселенная имеет форму додекаэдра, под заголовком «Действительно ли такова форма Вселенной?»

******Еще одним замечательным следствием того, что ДНК представляет из себя фрактальную антенну, является ее прямая связь с электромагнитным полем, создаваемым нашим сердцем. Как объясняет Дэн Винтер, нисхождение длинных волн каскадом в более короткие волны – это механизм, который используется для передачи вибрации поля сердца в нашу ДНК. Хотя длина волны ЭКГ и ДНК разные, их связывает между собой соотношение – пропорции ряда Золотого Сечения. Опять принцип подобия – Omnia in Unum.

Но это в идеале, конечно. В реальности-то мы редко пребываем в гармонии с ритмами Вселенной, поэтому и ЭКГ, и ДНК у большинства людей имеют разного рода отклонения.

Важно понимать, что наше душевное состояние, отражающееся в гармоничности электромагнитного поля сердца, через механизм подобия частей целому влияет на состояние имунной системы клеток. На бытовом уровне мы прекрасно знаем, что позитивные эмоции нас исцеляют. Теперь мы также понимаем, почему так происходит: положительные чувства, любовь, которые являются волнами, несущими совершенную подпись золотого эталона, программируют ДНК, которая по замыслу Творца также является воплощением золотого эталона.

Но знает Он путь мой: пусть испытает меня - выйду как золото(Иов, 23:10)

Автор каллиграфической работы Sabahattin Kayis

assalam786.livejournal.com


Смотрите также